Immunosuppressive alkaloids from Narcissus tazetta subsp. Chinensis and the mechanism of (+)-narciclasine in vitro and in vivo.

Three previously undescribed and sixteen known alkaloids were bioguidedly isolated from the bulbs of Narcissus tazetta subsp. chinensis (M.Roem.) Masamura & Yanagih. The structures were elucidated by spectroscopic data, including HRESIMS, NMR, and ECD. Eleven of the isolated alkaloids exhibited immunosuppressive activity on the proliferation of human T cells. (+)-Narciclasine (18) showed the most significantly suppressive activity with an IC50 value of 14 ± 5 nM. In vitro, (+)-narciclasine (18) blocked NF-κB signal transduction, but did not affect PI3K/AKT signal transduction. What was more, (+)-narciclasine significantly reduced ALT and AST levels and alleviated liver damage induced by ConA in AIH mouse model.

The Anti-Cholinesterase Potential of Fifteen Different Species of Narcissus L. (Amaryllidaceae) Collected in Spain.

Narcissus L. is a renowned plant genus with a notable center of diversity and is primarily located in the Mediterranean region. These plants are widely recognized for their ornamental value, owing to the beauty of their flowers; nonetheless, they also hold pharmacological importance. In Europe, pharmaceutical companies usually use the bulbs of Narcissus pseudonarcissus cv. Carlton to extract galanthamine, which is one of the few medications approved by the FDA for the palliative treatment of mild-to-moderate symptoms of Alzheimer's disease. The purpose of this study was to evaluate the potential of these plants in Alzheimer's disease. The alkaloid extract from the leaves of different species of Narcissus was obtained by an acid-base extraction work-up -procedure. The biological potential of the samples was carried out by evaluating their ability to inhibit the enzymes acetyl- and butyrylcholinesterase (AChE and BuChE, respectively). The species N. jacetanus exhibited the best inhibition values against AChE, with IC50 values of 0.75 ± 0.03 µg·mL-1, while N. jonquilla was the most active against BuChE, with IC50 values of 11.72 ± 1.15 µg·mL-1.

NtMYB12 requires for competition between flavonol and (pro)anthocyanin biosynthesis in Narcissus tazetta tepals.

The color of flowers is one of the main characteristics adopted for plants to attract pollinators to ensure the reproductive success of the plant, they are also important in their ornamental appeal in Narcissus plant. In this study, we identified a NtMYB12 locus encoding an R2R3-MYB transcription factor. Comparative transcriptome analysis of loss- and gain- of NtMYB12 tissue relative to wild-type narcissus showed NtMYB12 was mainly involved in flavonol and phenylpropanoid metabolic pathways. Biochemical evidences of dual-luciferase activity and chromatin immunoprecipitation assay supported that MYB12 directly bound to promoters of NtFLS, NtLAR, and NtDFR that were cloned by genome walking assay, and activated NtFLS and NtLAR expression but repressed NtDFR expression. More interestingly, NtMYB12 can interact with NtbHLH1 and NtWD40-1 proteins via R3 domain that were selected by transcriptome-based WGCNA and confirmed by yeast two hybrid, bimolecular fluorescence complementation and coimmunoprecipitation assay. Interaction of NtMYB12 with NtbHLH1 and NtWD40-1 forming MYB-bHLH-WD40 triplex specially activated NtDFR and NtANS expression and promoted (pro)anthocyanin accumulation, while NtMYB12 alone activated NtFLS and NtLAR expression and accumulated flavonols, but repressed NtDFR expression. These results indicated that NtMYB12 alone or NtMYB12-bHLH1-WD40-1 triplex requires for competition of metabolism fluxes between flavonol and (pro)anthocyanin biosynthesis. NtMYB12 dually functions on flavonol and proanthocyanin biogenesis via physically binding to NtFLS and NtLAR promoter activating their expression and on (pro)anthocyanin biosynthesis via NtMYB12-NtWD40-NtbHLH (MBW) triplex activating NtDFR and NtANS expression. Requirement of NtMYB12 alone or MBW complex for the competition between flavonol and anthocyanin biosynthesis results in narcissus colorized petal traits.

Characterization of norbelladine synthase and noroxomaritidine/norcraugsodine reductase reveals a novel catalytic route for the biosynthesis of Amaryllidaceae alkaloids including the Alzheimer's drug galanthamine.

Amaryllidaceae alkaloids (AAs) are a large group of plant specialized metabolites with diverse pharmacological properties. Norbelladine is the entry compound in AAs biosynthesis and is produced from the condensation of tyramine and 3,4-dihydroxybenzaldehyde (3,4-DHBA). There are two reported enzymes capable of catalyzing this reaction in-vitro, both with low yield. The first one, norbelladine synthase (NBS), was shown to condense tyramine and 3,4-DHBA, while noroxomaritidine/norcraugsodine reductase (NR), catalyzes a reduction reaction to produce norbelladine. To clarify the mechanisms involved in this controversial step, both NBS and NR homologs were identified from the transcriptome of Narcissus papyraceus and Leucojum aestivum, cloned and expressed in Escherichia coli. Enzymatic assays performed with tyramine and 3,4-DHBA with each enzyme separately or combined, suggested that NBS and NR function together for the condensation of tyramine and 3,4-DHBA into norcraugsodine and further reduction into norbelladine. Using molecular homology modeling and docking studies, we predicted models for the binding of tyramine and 3,4-DHBA to NBS, and of the intermediate norcraugsodine to NR. Moreover, we show that NBS and NR physically interact in yeast and in-planta, that both localize to the cytoplasm and nucleus and are expressed at high levels in bulbs, confirming their colocalization and co-expression thus their ability to work together in the same catalytic route. Finally, their co-expression in yeast led to the production of norbelladine. In all, our study establishes that both NBS and NR participate in the biosynthesis of norbelladine by catalyzing the first key steps associated in the biosynthesis of the Alzheimer's drug galanthamine.

In Silico Virome Analysis of Chinese Narcissus Transcriptomes Reveals Diverse Virus Species and Genetic Diversity at Different Flower Development Stages.

Viromes of Chinese narcissus flowers were explored using transcriptome data from 20 samples collected at different flower development stages. Quality controlled raw data underwent de novo assembly, resulting in 5893 viral contigs that matched the seven virus species. The most abundant viruses were narcissus common latent virus (NCLV), narcissus yellow stripe virus (NYSV), and narcissus mottling-associated virus (NMaV). As flower development stages advanced, white tepal plants showed an increase in the proportion of viral reads, while the variation in viral proportion among yellow tepal plants was relatively small. Narcissus degeneration virus (NDV) dominated the white tepal samples, whereas NDV and NYSV prevailed in the yellow tepal samples. Potyviruses, particularly NDV, are the primary infectious viruses. De novo assembly generated viral contigs for five viruses, yielding complete genomes for NCLV, NDV, narcissus late season yellow virus (NLSYV), and NYSV. Phylogenetic analysis revealed genetic diversity, with distinct NCLV, NMaV, NDV, NLSYV, and NYSV groups. This study provides valuable insights into the viromes and genetic diversity of viruses in Chinese narcissus flowers.

NtMYB1 and NtNCED1/2 control abscisic acid biosynthesis and tepal senescence in Chinese narcissus (Narcissus tazetta).

Chinese narcissus (Narcissus tazetta var. chinensis cv. 'Jinzhanyintai') is one of the 10 most famous traditional flowers of China, having a beautiful and highly ornamental flower with a rich fragrance. However, the flower longevity affects its commercial appeal. While petal senescence in Narcissus is ethylene-independent and abscisic acid-dependent, the regulatory mechanism has yet to be determined. In this study, we identified a R2R3-MYB gene (NtMYB1) from Narcissus tazetta and generated oeNtMYB1 and Ntmyb1 RNA interference mutants in Narcissus as well as an oeNtMYB1 construct in Arabidopsis. Overexpressing NtMYB1 in Narcissus or Arabidopsis led to premature leaf yellowing, an elevated level of total carotenoid, a reduced level of chlorophyll b, and a decrease in photosystem II fluorescence (Fv/Fm). A dual-luciferase assay and chromatin immunoprecipitation-quantitative PCR revealed that NtMYB1 directly binds to the promoter of NtNCED1 or NtNCED2 and activates NtNCED1/2 gene expression both in vitro and in vivo. Moreover, overexpressing NtMYB1 accelerated abscisic acid biosynthesis, up-regulated the content of zeatin and abscisic acid, and down-regulated the level of ß-carotene and gibberellin A1, leading to petal senescence and leaf yellowing in Narcissus. This study revealed a regulatory process that is fundamentally different between non-photosynthetic organs and leaves.

Emergence of Corona Is Independent of the Four Whorls of Floral Organs in Narcissus tazetta.

Plants of the genus Narcissus are well-known for their characteristic corona morphology, which structural origins have been a bone of contention among scholars. With "Jinzhanyintai" (JZ) and "Yulinglong" (YLL)-two major close-originated cultivars of Chinese narcissus (Narcissus tazetta L. var. chinensis Roem)-as materials, anatomic observation was made on floral organs during corona morphogenesis by dissection with hands under a stereomicroscope, paraffin section, scanning electron microscopy, and high-resolution X-ray tomography. It was uncovered that corona primordia of both cultivars appeared following the end of the differentiation of other floral organs, with differentiation sites located at the inner wall of the juncture of the base of tepals and the upper margin of the hypanthium. Affected by staminal filaments, the corona primordia of JZ experienced a three-stage differentiation process, namely blockage from the second whorl of stamens, blockage from the first whorl of stamens, and healing of corona primordia. However, the expanded spatial structure of the first whorl of petal-like stamens blocked the path of differentiation of YLL corona primordia, giving rise to slow differentiation of the corona primordia at the base of the first whorl of petal-like stamens and malformed differentiation of the corona primordia in the interval between the two whorls of petal-like stamens. Thus, a fragmented structure consisting of typical and fragmented coronas was formed. Furthermore, petal-like stamens of YLL in the lower part had a corona-like morphology. The spatio-temporal specificity of corona differentiation convincingly demonstrates that the corona is a structure independent of and different from the typical four whorls of floral organs, but also highly correlated with stamen.

First Report of Narcissus late season yellows virus, Narcissus latent virus, and Narcissus mosaic virus in daffodil (Narcissus pseudonarcissus) in the United States.

Daffodils (family Amaryllidaceae, genus Narcissus) are important ornamental plants produced primarily for cut flowers. In 2019, daffodils sales in the US were $6.26 M (USDA-NASS, 2019). In May 2021, four symptomatic daffodil plants (Narcissus pseudonarcissus) were sampled from a flowerbed (<10% disease incidence) on the Utah State University campus, Logan, Utah. The plants had foliar mosaic and yellow striping symptoms like those caused by the infections of Narcissus degeneration virus (NDV, a potyvirus) and Narcissus mosaic virus (NMV, a potexvirus) (Hanks and Chastagner 2017), and tested positive for potyviruses by ELISA Potyvirus group test (Agdia, Elkhart, IN). A sample of two leaves from the only surviving plant was sent to the USDA Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL) for testing. Total RNA extracted from 0.2 g pooled tissues (0.1g per leaf) using RNeasy Plant Mini kit (Qiagen) was tested for potyvirus in RT-PCR using Nib2F & Nib3R primers (Zheng et al. 2010). Later, the sample was tested for Narcissus latent virus (NLV) and NMV by RT-PCR (He et al. 2018) after the viruses were detected by high throughput sequencing (HTS) described below. A second primer pair was designed in-house targeting NMV TGB1 protein (NMV-2F: CCTTACACCACCGATCCTAAAG & NMV-2R: GGAGCTGCAGTGATGACATATAG. Amplicon size =555bp). The nucleotide (nt) sequence of the potyvirus RT-PCR product obtained (281 bp; GenBank accession no. ON653017) shared 99.29% identity with Narcissus late season yellows virus (NLSYV) BC 37 isolate (MH886515). The nt sequence of NLV-specific primer amplified product (542 bp; ON653018) showed 97.60% identity with NLV NL isolate (KX979913), a maculavirus. The amplicons obtained using two NMV-specific primer pairs were 348 bp (ON653019) and 524 bp (ON653020) long and shared 89.37% and 91.98% nt sequence identities with NMV SW13-Iris isolate (KF752593) at two genomic regions (5613-6860 nt and 5477-6000 nt), respectively. To obtain full genome sequences of the viruses in the sample, HTS was done. A cDNA library was prepared from 500 ng total RNA using the Direct cDNA sequencing kit (SQK-DCS109). The library was loaded onto an R9.4.1 MinION flow cell and sequenced for 48 hours. A total of 372,000 raw reads were obtained with a N50 of 2,754 bp and mean read length of 1,890 bp with 8,085 reads mapped to the viral database. Reads were assembled using canu v 2.1.1 (Koren et al. 2017). Three full-length viral contigs, ON677368 (6955 nt), ON677369 (9624 nt), and ON677370 (8180 nt), were assembled from 4616, 301, and 699 reads, respectively. BLASTn search showed that the three contigs (ON677368, ON677369, and ON677370) shared 94.42% nt identity with NMV SW13-Iris (KF752593), 98.56% with NLSYV BC 37 (MH886515.1), and 98.60% with NLV NL (KX979913.1) isolates, respectively. The potexvirus group, which NMV is a member, has species demarcation of < 72% nt identity (or 80% aa identity) between their coat protein or replicase genes (ICTV 2021). The predicted replicase protein sequence (1643 aa) of the detected NMV (ON677368) showed 95% identity with a published NMV genome (P15059), confirming its identity. NDV was not detected in the sample by RT-PCR and HTS. This is the first report of NLMV, NLSYV, and NMV in daffodil plants in the United States. Daffodils are an important ornamental crop in United States and Europe. A reduction in flower quality, bulb size, and number has been observed in plants infected with these viruses (Ward et al. 2009) that can affect their marketability.

Evaluation of floral volatile patterns in the genus Narcissus using gas chromatography-coupled ion mobility spectrometry.

Premise: Daffodils (Narcissus, Amaryllidaceae) are iconic ornamentals with a complex floral biology and many fragrant species; however, little is known about floral plant volatile organic compounds (pVOCs) across the genus and additional sampling is desirable. The present study investigates whether the floral scent of 20 species of Narcissus can be characterized using gas chromatography-coupled ion mobility spectrometry (GC-IMS), with the aim of building a comparative pVOC data set for ecological and evolutionary studies. Methods: We used a commercial GC-IMS equipped with an integrated in-line enrichment system for a fast, sensitive, and automated pVOC analysis. This facilitates qualitative and (semi)-quantitative measurements without sample preparation. Results: The GC-IMS provided detailed data on floral pVOCs in Narcissus with very short sampling times and without floral enclosure. A wide range of compounds was recorded and partially identified. The retrieved pVOC patterns showed a good agreement with published data, and five "chemotypes" were characterized as characteristic combinations of floral volatiles. Discussion: The GC-IMS setup can be applied to rapidly generate large amounts of pVOC data with high sensitivity and selectivity. The preliminary data on Narcissus obtained here indicate both considerable pVOC variability and a good correspondence of the pVOC patterns with infrageneric classification, supporting the hypothesis that floral scent could represent a considerable phylogenetic signal.

Identification of haemanthamine as a phytotoxic alkaloid in Narcissus pseudonarcissus L. (Daffodil) emerging buds.

Emerging buds of Narcissus pseudonarcissus were found to accumulate the alkaloid haemanthamine (1) at high concentrations, exceeding that of narciclasine (2), the most abundant constituent in bulbs of the plant. A phytoactivity screening assay demonstrated the novel phytotoxicity of haemanthamine against Raphanus sativus (radish), Lactuca sativus (lettuce), Triticum aestivum (red wheat), Solanum lycopersicum (tomato), Cucumis sativus (cucumber), Ipomoea (Morning glory), and Lens culinaris (lentil). Haemanthamine (1) phytotoxicity was found to exceed that of the commercial herbicide glyphosate and less toxic than narciclasine (2).

Alkaloid Profile in Wild Autumn-Flowering Daffodils and Their Acetylcholinesterase Inhibitory Activity.

Amaryllidaceae alkaloids are secondary metabolites with interesting medicinal properties. Almost every Narcissus species can synthesize them and constitute an excellent source for their isolation and study. Several Amaryllidaceae alkaloids have shown acetylcholinesterase inhibitory activities and are a promising tool for treating cholinergic disorders such as Alzheimer's disease (AD). Indeed, three of the four palliative treatments approved for AD are acetylcholinesterase (AChE) inhibitors and one of them, galanthamine, is an Amaryllidaceae alkaloid itself. This molecule is currently isolated from natural sources. However, its production is insufficient to supply the increasing demand for the active principle. Our main aim is to discover tools to improve galanthamine production and to prospect for potential new and more efficient drugs for AD treatment. Furthermore, we seek to broaden the knowledge of plants of the genus Narcissus from a chemotaxonomic perspective. Hence, in this study, we evaluate the alkaloid content through GC-MS and the AChE inhibitory activity of ten autumn-flowering Narcissus, which have been less studied than their spring-flowering counterparts. A total of thirty Amaryllidaceae alkaloids have been found, twenty-eight properly identified. Two Narcissus contained galanthamine, and seven were able to inhibit AChE.

Narcisismo: considerações atuais / Narcissism: considerations today / Narcisismo: consideraciones actuales

A autora revê o conceito de narcisismo desenvolvido por Freud e o contrapõe ao conceito de individuação de Jung. A partir do mito de Eco e Narciso e seguindo a descrição de C. Byington das funções estruturantes criativas e defensivas, a autora descreve as polaridades narcisismo ­ ecoísmo como funções estruturantes criativas e defensivas. Faz uma releitura do mito desde a normalidade até a desestruturação psicótica das personalidades de Eco e Narciso, dentro da inter-relação criativa-defensiva da polaridade narcisismo-ecoísmo. Conclui citando Jung para ressaltar a importância da relação Eu-Tu no processo de individuação.

The author reviews the concept of narcissism in psychoanalysis contrasting it with Jung's concept of individuation. Starting with the myth of Echo and Narcissus following C. Byington's description of creative and defensive structuring functions, the author describes the narcissismechoism polarity in a similar way. She interprets the myth of Echo and Narcissus from normality to the psychotic reaction of their personalities, within the creative-defensive inter-relationship of the narcissism-echoism polarity. She concludes by quoting Jung to emphasize the importance of the ego-other relationship in the individuation process.

La autora revisa el concepto de narcisismo desarrollado por Freud y lo contrapone al concepto de individuación de Jung. A partir del mito de Eco y Narciso, y siguiendo la descripción de C. Byington sobre las funciones estructurantes creativas y defensivas, la autora describe las polaridades narcisismo-ecoísmo como funciones estructurantes creativas y defensivas. Hace una relectura del mito desde la normalidad hasta la desestructuración psicótica de las personalidades de Eco y Narciso, dentro de la interrelación creativa-defensiva de la polaridad narcisismo-ecoísmo. Concluye citando a Jung para resaltar la importancia de la relación Yo-Tu en el proceso de individuación.

Spatiotemporal changes of tissue glycans depending on localization in cardiac aging.

Heart failure is caused by various factors, making the underlying pathogenic mechanisms difficult to identify. Since cardiovascular disease tends to worsen over time, early diagnosis is key for treatment. In addition, understanding the qualitative changes in the heart associated with aging, where information on the direct influences of aging on cardiovascular disease is limited, would also be useful for treatment and diagnosis. To fill these research gaps, the focus of our study was to detect the structural and functional molecular changes associated with the heart over time, with a focus on glycans, which reflect the type and state of cells. METHODS: We investigated glycan localization in the cardiac tissue of normal mice and their alterations during aging, using evanescent-field fluorescence-assisted lectin microarray, a technique based on lectin-glycan interaction, and lectin staining. RESULTS: The glycan profiles in the left ventricle showed differences between the luminal side (medial) and wall side (lateral) regions. The medial region was characterized by the presence of sialic acid residues. Moreover, age-related changes in glycan profiles were observed at a younger age in the medial region. The difference in the age-related decrease in the level of α-galactose stained with Griffonia simplicifolia lectin-IB4 in different regions of the left ventricle suggests spatiotemporal changes in the number of microvessels. CONCLUSIONS: The glycan profile, which retains diverse glycan structures, is supported by many cell populations, and maintains cardiac function. With further research, glycan localization and changes have the potential to be developed as a marker of the signs of heart failure.

Structural analysis of unusual alkaloids isolated from Narcissus pseudonarcissus cv. Carlton.

Narciindole A, the first representative of Amaryllidaceae alkaloids with an indol-3-ylmethanone framework, was isolated from bulbs of Narcissus pseudonarcissus (L.) cv. Carlton, together with carltonine D and carltonine E, which share the same unusual structural motif as dimeric carltonine C (reported in 2020), exhibiting atropisomerism. Unambiguous structure elucidations have been achieved by NMR spectroscopy, HRMS, and comparison with literature data of related alkaloids. Furthermore, the chirality of known alkaloids with a galanthindole biaryl core was revised using optical rotation. Last, but not least, a biosynthetic pathway for dimeric carltonine-type alkaloids was proposed. Unfortunately, in terms of biological activity, the isolated alkaloids showed only moderate inhibition of human acetylcholinesterase and/or butyrylcholinesterase.

Nanoporous silica gel can compete with the flower stigma in germinating and attracting pollen tubes.

To find nanoporous substrates with hydrodynamic properties useful for pollen hydration and germination, we used the glassy Silica gel and Vycor scales and pollen with different morphological and physiological traits, that of Crocus vernus, and that of Narcissus poeticus. For in vitro tests, the scales were spread on microscope slides, hand pollinated, and incubated. Pollen germination was evaluated with the stereomicroscope and the tube growth was explored with scanning electron microscopy (SEM). The in vivo tests were carried out by sprinkling the stigmas of the Crocus plants with Silica gel scales and immediately after having pollinated them by hand, the plants were incubated. Three hours later, the stigmas were removed and treated for observation with SEM. In vitro the pollen of both species germinated on Silica gel with percentages similar to those of the in vivo and in vitro controls, accumulating fibrillary material at the interface. The tubes grew perpendicular to the surface of the scales, trying to penetrate the scales to the point of flattening with the apex. On Crocus stigmas sprinkled with Silica gel scales, pollen developed tubes that grew to the scales rather than penetrating the papillae. The results underline the close interaction of pollen with nanoporous artificial material, so much so that its pollen tubes are attracted to the Silica scales more than to the stigma papillae that arises from a mechanism of natural selection.

Direct evidence supporting Darwin's hypothesis of cross-pollination promoted by sex organ reciprocity.

The floral phenotype plays a main role in the attraction and fit of pollinators. Both perianth traits and the positioning of sex organs can be subjected to natural selection and determine nonrandom mating patterns in populations. In stylar-polymorphic species, the Darwinian hypothesis predicts increased mating success between individuals with sex organs at equivalent heights (i.e. with higher reciprocity). We used paternity analyses in experimental populations of a stylar-dimorphic species. By comparing the observed mating patterns with those expected under random mating, we tested the effects of sex organ reciprocity and perianth traits on mating success. We also analysed phenotypic selection on perianth traits through female and male functions. The (dis)similarity of parental perianth traits had no direct effects on the mating patterns. Sex organ reciprocity had a positive effect on mating success. Narrow floral tubes increased this effect in upper sex organs. Perianth traits showed little signs of phenotypic selection. Female and absolute fitness measures resulted in different patterns of phenotypic selection. We provide precise empirical evidence of the Darwinian hypothesis about the functioning of stylar polymorphisms, demonstrating that mating patterns are determined by sex organ reciprocity and only those perianth traits which are critical to pollinator fit.

Synonymous Codon Usage Analysis of Three Narcissus Potyviruses.

Narcissus degeneration virus (NDV), narcissus late season yellows virus (NLSYV) and narcissus yellow stripe virus (NYSV), which belong to the genus Potyvirus of the family Potyviridae, cause significant losses in the ornamental value and quality of narcissus. Several previous studies have explored the genetic diversity and evolution rate of narcissus viruses, but the analysis of the synonymous codons of the narcissus viruses is still unclear. Herein, the coat protein (CP) of three viruses is used to analyze the viruses' phylogeny and codon usage pattern. Phylogenetic analysis showed that NYSV, NDV and NLSYV isolates were divided into five, three and five clusters, respectively, and these clusters seemed to reflect the geographic distribution. The effective number of codon (ENC) values indicated a weak codon usage bias in the CP coding region of the three narcissus viruses. ENC-plot and neutrality analysis showed that the codon usage bias of the three narcissus viruses is all mainly influenced by natural selection compared with the mutation pressure. The three narcissus viruses shared the same best optimal codon (CCA) and the synonymous codon prefers to use codons ending with A/U, compared to C/G. Our study shows the codon analysis of different viruses on the same host for the first time, which indicates the importance of the evolutionary-based design to control these viruses.

Cytotaxonomic investigations on species of genus Narcissus (Amaryllidaceae) from Algeria.

This paper provides new cytotaxonomic data on the genus Narcissus Linnaeus, 1753, in Algeria. Populations of seven taxa, N.tazetta Linnaeus, 1753, N.pachybolbus Durieu, 1847, N.papyraceus Ker Gawler, 1806, N.elegans (Haworth) Spach, 1846, N.serotinus sensu lato Linnaeus, 1753, including N.obsoletus (Haworth) Steudel, 1841, and N.cantabricus De Candolle, 1815, were karyologically investigated through chromosome counting and karyotype parameters. N.tazetta and N.elegans have the same number of chromosomes 2n = 2x = 20 with different karyotype formulas. Karyological and morphological characteristics, confirm the specific status of N.pachybolbus and N.papyraceus, both are diploids with 2n = 22 but differing in asymmetry indices. The morphotypes corresponding to N.serotinus sensu lato show two ploidy levels 2n = 4x = 20 and 2n = 6x = 30 characterized by a yellow corona. Some hexaploid cytotypes have more asymmetric karyotype with predominance of subtelocentric chromosomes. They are distinguished by orange corona and may correspond to N.obsoletus. Other cytotype 2n = 28 of N.serotinus was observed in the North Western biogeographic sectors. N.cantabricus was found to be diploid with 2n = 2x = 14, which is a new diploid report in the southernmost geographic range of this polyploid complex.

A novel plant lectin, NTL-125, interferes with SARS-CoV-2 interaction with hACE2.

COVID-19 caused by SARS-CoV-2 virus has had profound impact on the world in the past two years. Intense research is going on to find effective drugs to combat the disease. Over the past year several vaccines were approved for immunization. But SARS-CoV-2 being an RNA virus is continuously mutating to generate new variants, some of which develop features of immune escape. This raised serious doubts over the long-term efficacy of the vaccines. We have identified a unique mannose binding plant lectin from Narcissus tazetta bulb, NTL-125, which effectively inhibits SARS-CoV-2 replication in Vero-E6 cell line. In silico docking studies revealed that NTL-125 has strong affinity to viral Spike RBD protein, preventing it from attaching to hACE2 receptor, the gateway to cellular entry. Binding analyses revealed that all the mutant variants of Spike protein also have stronger affinity for NTL-125 than hACE2. The unique α-helical tail of NTL-125 plays most important role in binding to RBD of Spike. NTL-125 also interacts effectively with some glycan moieties of S-protein in addition to amino acid residues adding to the binding strength. Thus, NTL-125 is a highly potential antiviral compound of natural origin against SARS-CoV-2 and may serve as an important therapeutic for management of COVID-19.

Narcissus Plants: A Melting Pot of Potyviruses.

Our paper presents detailed evolutionary analyses of narcissus viruses from wild and domesticated Narcissus plants in Japan. Narcissus late season yellows virus (NLSYV) and narcissus degeneration virus (NDV) are major viruses of Narcissus plants, causing serious disease outbreaks in Japan. In this study, we collected Narcissus plants showing mosaic or striped leaves along with asymptomatic plants in Japan for evolutionary analyses. Our findings show that (1) NLSYV is widely distributed, whereas the distribution of NDV is limited to the southwest parts of Japan; (2) the genomes of NLSYV isolates share nucleotide identities of around 82%, whereas those of NDV isolates are around 94%; (3) three novel recombination type patterns were found in NLSYV; (4) NLSYV comprises at least five distinct phylogenetic groups whereas NDV has two; and (5) infection with narcissus viruses often occur as co-infection with different viruses, different isolates of the same virus, and in the presence of quasispecies (mutant clouds) of the same virus in nature. Therefore, the wild and domesticated Narcissus plants in Japan are somewhat like a melting pot of potyviruses and other viruses.