Antiaging effects of a skin care formulation containing nanoencapsulated antioxidants: A clinical, in vitro, and ex vivo study.

BACKGROUND: The development of effective cosmetic products for the reduction of the signs of skin aging is a complex process which requires an optimized combination of ingredients and specialized systems to deliver the actives to the skin layers. AIM: To evaluate the tolerance and antiaging clinical efficacy of a cosmetic formulation containing a blend of nanoencapsulated antioxidants: ascorbyl palmitate, resveratrol, tocopherol, caffeine, carnosine, and niacinamide. METHODS: Clinical efficacy was determined by subjective and instrumental analyses of collagen synthesis by fluorescence spectroscopy, by three-dimensional imaging analysis of suborbital edema, and by analysis of skin hydration and sebum content by biophysical techniques-Corneometer® and Sebumeter®. RESULTS: The studied formulation was safe and effective for the improvement of skin appearance by increasing collagen synthesis and skin moisturizing and by reducing facial blemishes, swelling, and oiliness. A preclinical exploratory approach using an experimental model of human cell and skin cultures agreed with the observed antiaging effects, identifying mechanisms related to the containment of oxidative stress, reduction of melanin production, increased synthesis of type I procollagen, and regulation of the epidermal cohesion protein filaggrin. CONCLUSIONS: The skin benefits obtained resulted from the combination of the ingredients in the formulation and the nanoencapsulation-based delivery system, which favors the solubility, safety, efficacy, and bioavailability of the preparation to the skin.

Vernix caseosa reveals mechanistic clues linking maternal obesity to atopic dermatitis pathogenesis.

BACKGROUND: Maternal overweight and obesity have been associated with an increased risk of atopic dermatitis (AD) in the offspring, but the underlying mechanisms are unclear. Vernix caseosa (VC) is a proteolipid material covering the fetus produced during skin development. However, whether maternal prepregnancy weight excess influences fetal skin development is unknown. Characterizing the VC of newborns from mothers with prepregnancy overweight and obesity might reveal AD-prone alterations during fetal skin development. OBJECTIVE: We sought to explore AD biomarkers and staphylococcal loads in VC from the offspring of mothers who were overweight/obese (O/O) before pregnancy versus in those from offspring of normal weight mothers. METHODS: The VC of newborns of 14 O/O and 12 normal weight mothers were collected immediately after birth. Biomarkers were determined by ELISA and staphylococcal species by quantitative PCR. RESULTS: The VC from the O/O group showed decreased expression of skin barrier proteins (filaggrin and loricrin) and increased levels of proinflammatory biomarkers (IgA, thymic stromal lymphopoietin [TSLP], S100A8, IL-25, and IL-33). No differences in concentrations of antimicrobial peptides and enzymes were detected. The VC from the O/O group had a lower Staphylococcus epidermidis and Staphylococcus hominis commensal bacterial load, whereas Staphylococcus aureus bacterial load was not significantly different between the 2 groups. Maternal body mass index was negatively correlated with VC filaggrin expression and S epidermidis load and was positively associated with TSLP concentration. One-year follow-up established that the offspring of O/O mothers had a higher incidence of AD that was specifically linked with decreased VC filaggrin expression and lower S epidermidis load. CONCLUSIONS: VC from neonates of mothers with prepregnancy overweight and obesity exhibit skin barrier molecular alterations and staphylococcal dysbiosis that suggest early mechanistic clues to this population's increased risk of AD.

Genetic polymorphism (rs6587666) in FLG protects from eczema in admixed Brazilian children population with high African ancestry.

Genetic variants in filaggrin (FLG) are key in eczema and are less common in Africans than in Europeans and Asians. Here we examined the association between FLG Single Nucleotide Polymorphisms (SNPs) and eczema in a population of admixed Brazilian children and whether African ancestry modifies this association. We included 1010 controls and 137 cases and ran logistic regressions between SNPs in FLG and eczema in the studied population and also stratified the analyses according to the degree of African ancestry. In addition, we tested the replication of the findings on an independent set of individuals, as well as, we verified the impact on FLG expression according to each SNP genotype. The T allele of SNP rs6587666 was negatively associated with eczema in additive model (OR: 0.66, 95% CI: 0.47-0.93, P: 0.017). Moreover, African ancestry modifies the association between rs6587666 and eczema. The effect of the T allele was higher among individuals with higher African ancestry and the association with eczema was lost in individuals with lower African ancestry. In our analyses the expression of FLG in skin was slightly downregulated by the presence of the T allele of rs6587666. In our population, the T allele of rs6587666 in FLG was associated with protection to eczema and the degree of African ancestry was able to modify the observed association.

Novel topical skin hydration agent containing Anadenanthera colubrina polysaccharide-standardized herbal preparation.

BACKGROUND: Hydration is an important factor to promote skin barrier function, metabolism, and appearance. In this process, the presence of aquaglyceroporins, envelope and lipid synthesis, and metabolism proteins are essential to provide greater corneocyte cohesion and to form a barrier avoiding transepidermal water loss. OBJECTIVE: We evaluated the effects of a new topical pigment-free agent containing an Anadenanthera colubrina polysaccharide-rich dermocosmetic preparation (ACP) on the aquaporin-3 (AQP-3), filaggrin (FLG), involucrin (INV), glucocerebrosidase (GBA), and elongation of very-long-chain fatty acid (ELOVL) proteins production in skin human fragments, as well as on the transepidermal water loss in a double-blind placebo-controlled clinical trial. METHODS: AQP3, FLG, INV, GBA, and ELOVL3 levels were measured by immunofluorescence analysis in human skin explants. Clinical trial was conducted to evaluate the effects of ACP 1% and ACP 3% on the transepidermal water loss (TEWL). RESULTS: Image and statistical analysis showed that ACP 3% significantly increased at 90% the expression of AQP3. Similarly, ACP 3% was able to promote a significant increase of 68% and 51% in FLG and INV, respectively. ACP 3% produced no effects on the GBA and ELOVL3 proteins. Transepidermal water loss was significantly reduced in human volunteers under treatment with ACP 1% and ACP 3%. CONCLUSION: ACP reduced transepidermal water loss in a clinical trial, promoting human skin hydration. These effects were related to modulation of the AQP3, FLG, and INV as evidenced by immunofluorescence assay. This way, A colubrina polysaccharide-rich phytopharmaceutical preparation is an effective additive product to skin hydration.

Dermatitis atópica: Pitiriasis alba. A propósito de un caso / Atopic Dermatitis: Pityriasis Alba. A clinical case

RESUMEN La Pitiriasis alba es una enfermedad cutánea inespecífica de etiología desconocida, caracterizada por máculas hipocrómicas, redondeadas u ovaladas poco delimitadas y cubiertas con escamas finas que ocurren usualmente en la región facial de los niños. Fue descrita por Gilbert en 1860 y Fox en 1923, pero fue O'Farrell en 1956 quien propuso el nombre de Pitiriasis alba. La condición dermatológica con la que suele asociarse es la dermatitis atópica. La presencia de Pitiriasis alba fue definida como uno de los criterios menores para el diagnóstico de Dermatitis atópica, según Hanifin y Rajka en 1980. Sin embargo, también se presenta en 20-40% de los niños atópicos, sin evidencia de Dermatitis atópica, así como en individuos no atópicos. La disfunción de la barrera epitelial causada por mutaciones del gen de la filagrina, proteína estructural epidérmica, que forma parte del factor humectante natural, se considera un factor de riesgo emergente para la Dermatitis atópica severa de comienzo precoz. Se presenta un caso de Pitiriasis albaen el que fue necesaria terapia combinada tópica y vía oral, con evolución satisfactoria en 8 semanas de tratamiento.

SUMMARY Pityriasis Alba is a non-specific skin disease of unknown etiology characterized by hypochromic macules, rounded or oval, poorly defined and covered with fine scales that usually occur in the facial region of children. It was described by Gilbert in 1860 and Fox in 1923, but it was O'Farrell in 1956 who proposed the name Pityriasis alba. The dermatological condition with which it is usually associated is Atopic dermatitis. The presence of Pityriasis alba was defined as one of the minor criteria for the diagnosis of Atopic dermatitis, according to Hanifin and Rajka in 1980. However, it also occurs in 20-40% of atopic children, without evidence of Atopic dermatitis, as well as in non-atopic individuals. Epithelial barrier dysfunction caused by mutations of the filaggrin gene, epidermal structural protein, which is part of the natural humectant factor, is considered an emerging risk factor for severe early onset Atopic dermatitis. We present a case of Pityriasis alba where combined topical and systemic therapy was necessary with satisfactory evolution in 8 weeks of treatment.

Brasilianoids A-F, New Meroterpenoids From the Sponge-Associated Fungus Penicillium brasilianum.

3,5-Dimethylorsellinic acid (DMOA) derived meroterpenoids comprise an unique class of natural products with diverse scaffolds and with a broad spectrum of bioactivities. Bioinformatics analysis of the gene clusters in association with the qRT-PCR detection of the amplification of two key genes led to speculate that the sponge associated fungus Penicillium brasilianum WZXY-m122-9 is a potential producer of meroterpenoids. Chromatographic separation of the EtOAc extract of this fungal strain on a large-scale fermentation resulted in the isolation of six new DMOA-related meroterpenoids with trivial names of brasilianoids A-F (1-6), together with preaustinoid D and preaustinoid A2. The structures were determined by extensive analyses of spectroscopic data, including the X-ray diffraction and the ECD data for configurational assignment. Brasilianoids A and F showed an unprecedented skeleton with a γ-lactone in ring A, while brasilianoids B-C featured a 7/6/6/5/5 pentacyclic ring system finding in nature for the first time. The biosynthetic relationship among the isolated compounds was postulated. Compound 1 significantly stimulated the expression of filaggrin and caspase-14 in HaCaT cells in dose-dependent manner, while compounds 2 and 3 showed moderate inhibition against NO production in LPS-induced RAW 264.7 macrophages.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Nuevos marcadores en el diagnóstico de la artritis reumatoide / New markers in the diagnosis of rheumatoid arthritis

Se hizo una revisión sobre otros marcadores de diagnóstico para la artritis reumatoidea, una de las enfermedades autoinmunes sistémicas más comunes y de amplia distribución mundial, que afecta principalmente a las mujeres y es muy agresiva en la raza negra. Su diagnóstico precoz resulta de vital importancia para evitar las deformidades articulares características y para mejorar la calidad de vida de los pacientes. Actualmente se diagnostica siguiendo los criterios de clasificación definidos por la American Rheumatism Association, entre ellos, la detección del factor reumatoideo. Hoy día se sabe que este no es patognomónico de la enfermedad porque puede estar presente en otras entidades. Se realizó una revisión de otros marcadores sexológicos que están asociados a la artritis reumatoidea y que son mucho más específicos, de manera que podría considerarse su uso en el diagnóstico precoz de esta enfermedad.

A review of other diagnostic markers for rheumatoid arthritis, one of the commonest autoimmune systemic diseases, was made. It is widely spread all over the world. It mainly affects women and it is very aggressive among black people. Its early diagnosis is of vital importance to prevent the characteristic joint deformities and to improve the patients’ quality of life. At present, it is diagnosed according to the classification criteria defined by the American Rheumatism Association, among them, the detection of the rheumatoid factor. It is known that it is not pathognomonic of the disease, since it may be present in other entities. A review of other sexological markers that are associated with rheumatoid arthritis and that are much more specific was made, so that their use could be considered in the early diagnosis of this disease,.