Prevalence and Classification of Pediatric Neuromuscular Disorders in the Central Region of Portugal.

Neuromuscular disorders are a group of rare heterogenous diseases with profound impact on quality of life, for which overall pediatric prevalence has rarely been reported. The purpose of this study was to determine the point prevalence of pediatric neuromuscular disorders and its subcategories in the central region of Portugal. Retrospective case identification was carried out in children with neuromuscular disorders seen between 1998 and 2020 from multiple data sources. Demographics, clinical and molecular diagnoses were registered. On January 1, 2020, the point overall prevalence in the population <18 years of age was 41.20/100 000 (95% confidence interval 34.51-49.19) for all neuromuscular disorders. The main case proportion were genetic disorders (95.7%). We found a relatively higher occurrence of limb-girdle muscular dystrophies, congenital myopathies, and spinal muscular atrophy and a slightly lower occurrence of Duchenne muscular dystrophy, hereditary spastic paraparesis, and acquired neuropathies compared to previous studies in other countries. Molecular confirmation was available in 69.5% of pediatric neuromuscular patients in our cohort.Total prevalence is high in comparison with the data reported in the only previous study on the prevalence of pediatric neuromuscular disorders in our country. Our high definitive diagnostic rate underscores the importance of advances in investigative genetic techniques, particularly new sequencing technologies, in the diagnostic workup of neuromuscular patients.

Core myopathy in two siblings with a biallelic variant in the CACNA1S gene-A case series study.

Homozygous variants of Calcium Voltage-Gated Channel Subunit Alpha1 S (CACNA1S) gene mutation were previously identified as causes of periodic paralysis and congenital early-onset myopathy, while it could be manifested as a late-onset congenital core myopathy. Abstract: Calcium Voltage-Gated Channel Subunit Alpha1 S (CACNA1S) gene mutation has been linked to various neuromuscular conditions in recent years. Congenital myopathy with core-like features is one of the cardinal associations reported previously, causing severe respiratory insufficiency and death in neonates. Informed consent was received from the patients. Subsequently, peripheral blood leukocytes were utilized to extract genomic DNA. Moreover, exome enrichment was implemented through the Twist Human Core Exome Kit (Twist Bioscience) and exome sequenced using Illumina NovaSeq 6000 platform (Illumina, San Diego, CA, USA). Sanger sequencing using BIG Dye Terminators confirmed the presence of the final variant. Finally, the candidate variants were classified based on the American College of Medical Genetics and Genomics (ACMG) guidelines. In this report, we describe two siblings, who presented with childhood and late-onset progressive muscle weakness, and had a homozygous variant in exon 2 of the CACNA1S gene defined as c.188C > A (p.Ala63Asp) (NM_000069.3). The SIFT, Polyphen2, CADD PHRED, and Mutation Taster analysis tools classified the variant as pathogenic/damaging. The muscle biopsy of the younger brother revealed intermyofibrillar network pattern disruption as cytoplasmic core-like lesions. The muscle magnetic resonance imaging (MRI) reported grade IIa and IIb fatty changes. Finally, the electromyography (EMG) findings suggested a myopathic change pattern. This report illustrates the clinical variability in CACNA1S-related myopathy by reviewing prior reports and adding newly found aspects, additionally expanding the gene defects associated with core myopathy.

A Contemporaneous Onset of Eosinophilic Granulomatosis with Polyangiitis and Myasthenia Gravis: A Case Report.

Autoimmune neuromuscular disorders in patients with eosinophilic granulomatosis with polyangiitis (EGPA) are relatively uncommon. Although two cases of myasthenia gravis (MG) comorbid with EGPA have been reported, both patients developed EGPA several years after starting immunosuppressive treatment for MG. We herein report a 75-year-old man with a rare co-occurrence of EGPA and MG that developed simultaneously and was successfully treated with immunosuppressive therapy. Distinguishing the neurological symptoms of EGPA from complications of other neurological autoimmune diseases, such as MG, is crucial, especially in patients with eosinophilia.

Practical recommendations for swallowing and speaking during NIV in people with neuromuscular disorders.

Objectives: The functions of eating, drinking, speaking, and breathing demand close coordination of the upper airway musculature which may be challenged by the long-term use of daytime non-invasive ventilation (NIV). This rapid review explores the challenges and practicalities of these interactions in people with neuromuscular disorders. Methods: A search was performed on PubMed (period 2000-2023) using generic terms to refer to eating, drinking, and speaking related to people with neuromuscular disorders on NIV. A narrative approach was used to summarize the available literature. Results: Our review shows only a small number of studies exist exploring the use of NIV on swallowing and speaking in people with neuromuscular disorders. We summarize study findings and provide practical advice on eating, drinking and speaking with NIV. Conclusions: By understanding breathing, NIV mechanics and upper airway interactions, it is possible to optimize swallowing and speaking whilst using NIV. There is a lack of specific guidelines, and concerns regarding aspiration warrant further research and guideline development.

Validity of Cardiopulmonary Exercise Testing for Assessing Aerobic Capacity in Neuromuscular Diseases.

OBJECTIVES: To determine the content validity of cardiopulmonary exercise testing (CPET) for assessing peak oxygen uptake (VO2peak) in neuromuscular diseases (NMD). DESIGN: Baseline assessment of a randomized controlled trial. SETTING: Academic hospital. PARTICIPANTS: Eighty-six adults (age: 58.0±13.9 y) with Charcot-Marie-Tooth disease (n=35), postpolio syndrome (n=26), or other NMD (n=25). INTERVENTION: Not applicable. MAIN OUTCOME MEASURES: Workload, gas exchange variables, heart rate, and ratings of perceived exertion were measured during CPET on a cycle ergometer, supervised by an experienced trained assessor. Muscle strength of the knee extensors was assessed isometrically with a fixed dynamometer. Criteria for confirming maximal cardiorespiratory effort during CPET were established during 3 consensus meetings of an expert group. The percentage of participants meeting these criteria was assessed to quantify content validity. RESULTS: The following criteria were established for maximal cardiorespiratory effort: a plateau in oxygen uptake (VO2plateau) as the primary criterion, or 2 of 3 secondary criteria: (1) peak respiratory exchange ratio (RERpeak) ≥1.10 (2), peak heart rate ≥85% of predicted maximal heart rate; and (3) peak rating of perceived exertion (RPEpeak) ≥17 on the 6-20 Borg scale. These criteria were attained by 71 participants (83%). VO2plateau, RERpeak ≥1.10, peak heart rate ≥85%, and RPEpeak ≥17 were attained by 31%, 73%, 69%, and 72% of the participants, respectively. Peak workload, VO2peak, and knee extension muscle strength were significantly higher, and body mass index was lower (all P<.05), in participants with maximal cardiorespiratory effort than other participants. CONCLUSIONS: Most people with NMD achieved maximal cardiorespiratory effort during CPET. This study provides high quality evidence of sufficient content validity of VO2peak as a maximal aerobic capacity measure. Content validity may be lower in more severely affected people with lower physical fitness.

Avoiding the use of long-term parenteral support in patients without intestinal failure: A position paper from the European Society of Clinical Nutrition & Metabolism, the European Society of Neurogastroenterology and Motility and the Rome Foundation for Disorders of Gut-Brain Interaction.

The role of long-term parenteral support in patients with underlying benign conditions who do not have intestinal failure (IF) is contentious, not least since there are clear benefits in utilising the oral or enteral route for nutritional support. Furthermore, the risks of long-term home parenteral nutrition (HPN) are significant, with significant impacts on morbidity and mortality. There has, however, been a recent upsurge of the use of HPN in patients with conditions such as gastro-intestinal neuromuscular disorders, opioid bowel dysfunction, disorders of gut-brain interaction and possibly eating disorders, who do not have IF. As a result, the European Society of Clinical Nutrition and Metabolism (ESPEN), the European Society of Neuro-gastroenterology and Motility (ESNM) and the Rome Foundation for Disorders of Gut Brain Interaction felt that a position statement is required to clarify - and hopefully reduce the potential for harm associated with - the use of long-term parenteral support in patients without IF. Consensus opinion is that HPN should not be prescribed for patients without IF, where the oral and/or enteral route can be utilised. On the rare occasions that PN commencement is required to treat life-threatening malnutrition in conditions such as those listed above, it should only be prescribed for a time-limited period to achieve nutritional safety, while the wider multi-disciplinary team focus on more appropriate biopsychosocial holistic and rehabilitative approaches to manage the patient's primary underlying condition.

CRISPR-Based Gene Therapies: From Preclinical to Clinical Treatments.

In recent years, clustered regularly interspaced short palindromic repeats (CRISPRs) and CRISPR-associated (Cas) protein have emerged as a revolutionary gene editing tool to treat inherited disorders affecting different organ systems, such as blood and muscles. Both hematological and neuromuscular genetic disorders benefit from genome editing approaches but face different challenges in their clinical translation. The ability of CRISPR/Cas9 technologies to modify hematopoietic stem cells ex vivo has greatly accelerated the development of genetic therapies for blood disorders. In the last decade, many clinical trials were initiated and are now delivering encouraging results. The recent FDA approval of Casgevy, the first CRISPR/Cas9-based drug for severe sickle cell disease and transfusion-dependent ß-thalassemia, represents a significant milestone in the field and highlights the great potential of this technology. Similar preclinical efforts are currently expanding CRISPR therapies to other hematologic disorders such as primary immunodeficiencies. In the neuromuscular field, the versatility of CRISPR/Cas9 has been instrumental for the generation of new cellular and animal models of Duchenne muscular dystrophy (DMD), offering innovative platforms to speed up preclinical development of therapeutic solutions. Several corrective interventions have been proposed to genetically restore dystrophin production using the CRISPR toolbox and have demonstrated promising results in different DMD animal models. Although these advances represent a significant step forward to the clinical translation of CRISPR/Cas9 therapies to DMD, there are still many hurdles to overcome, such as in vivo delivery methods associated with high viral vector doses, together with safety and immunological concerns. Collectively, the results obtained in the hematological and neuromuscular fields emphasize the transformative impact of CRISPR/Cas9 for patients affected by these debilitating conditions. As each field suffers from different and specific challenges, the clinical translation of CRISPR therapies may progress differentially depending on the genetic disorder. Ongoing investigations and clinical trials will address risks and limitations of these therapies, including long-term efficacy, potential genotoxicity, and adverse immune reactions. This review provides insights into the diverse applications of CRISPR-based technologies in both preclinical and clinical settings for monogenic blood disorders and muscular dystrophy and compare advances in both fields while highlighting current trends, difficulties, and challenges to overcome.

Deubiquitinases in muscle physiology and disorders.

In vivo, muscle and neuronal cells are post-mitotic, and their function is predominantly regulated by proteostasis, a multilayer molecular process that maintains a delicate balance of protein homeostasis. The ubiquitin-proteasome system (UPS) is a key regulator of proteostasis. A dysfunctional UPS is a hallmark of muscle ageing and is often impacted in neuromuscular disorders (NMDs). Malfunction of the UPS often results in aberrant protein accumulation which can lead to protein aggregation and/or mis-localization affecting its function. Deubiquitinating enzymes (DUBs) are key players in the UPS, controlling protein turnover and maintaining the free ubiquitin pool. Several mutations in DUB encoding genes are linked to human NMDs, such as ATXN3, OTUD7A, UCHL1 and USP14, whilst other NMDs are associated with dysregulation of DUB expression. USP5, USP9X and USP14 are implicated in synaptic transmission and remodeling at the neuromuscular junction. Mice lacking USP19 show increased maintenance of lean muscle mass. In this review, we highlight the involvement of DUBs in muscle physiology and NMDs, particularly in processes affecting muscle regeneration, degeneration and inflammation following muscle injury. DUBs have recently garnered much respect as promising drug targets, and their roles in muscle maturation, regeneration and degeneration may provide the framework for novel therapeutics to treat muscular disorders including NMDs, sarcopenia and cachexia.

Next generation sequencing panel as an effective approach to genetic testing in patients with a highly variable phenotype of neuromuscular disorders.

Neuromuscular disorders (NMDs) include a wide range of diseases affecting the peripheral nervous system. The genetic diagnoses are increasingly obtained with using the next generation sequencing (NGS). We applied the custom-design targeted NGS panel including 89 genes, together with genotyping and multiplex ligation-dependent probe amplification (MLPA) to identify a genetic spectrum of NMDs in 52 Polish patients. As a result, the genetic diagnosis was determined by NGS panel in 29 patients so its diagnostic utility is estimated at 55.8%. The most pathogenic variants were found in CLCN1, followed by CAPN3, SCN4A, and SGCA genes. Genotyping of myotonic dystrophy type 1 and 2 (DM1 and DM2) as a secondary approach has been performed. The co-occurrence of CAPN3 and CNBP mutations in one patient as well as DYSF and CNBP mutations in another suggests possibly more complex inheritance as well as expression of a phenotype. In 7 individuals with single nucleotide variant found in NGS testing, the MLPA of the CAPN3 gene was performed detecting the deletion encompassing exons 2-8 in the CAPN3 gene in one patient, confirming recessive limb-girdle muscular dystrophy type 1 (LGMDR1). Thirty patients obtained a genetic diagnosis (57.7%) after using NGS testing, genotyping and MLPA analysis. The study allowed for the identification of 27 known and 4 novel pathogenic/likely pathogenic variants and variants of uncertain significance (VUS) associated with NMDs.In conclusion, the diagnostic approach with diverse molecular techniques enables to broaden the mutational spectrum and maximizes the diagnostic yield. Furthermore, the co-occurrence of DM2 and LGMD has been detected in 2 individuals.

Waves of Precision: A Practical Guide for Reviewing New Tools to Evaluate Mechanical In-Exsufflation Efficacy in Neuromuscular Disorders.

Mechanical insufflation-exsufflation (MI-E) is essential for secretion clearance, especially in neuromuscular disorders. For the best outcomes, initiation of MI-E should be started at the correct time with regular evaluation to the response to treatment. Typically, cough peak flow has been used to evaluate cough effectiveness with and without MI-E. This review highlights the limitations of this and discussed other tools to evaluate MI-E efficacy in this rapidly developing field. Such tools include the interpretation of parameters (like pressure, flow and volumes) that derive from the MI-E device and external methods to evaluate upper airway closure. In this review we pinpoint the differences between different devices in the market and discuss new tools to better titrate MI-E and detect pathological responses of the upper airway. We discuss the importance of point of care ultrasound (POCUS), transnasal fiberoptic laryngoscopy and wave form analysis in this setting. To improve clinical practice newer generation MI-E devices should allow real-time evaluation of waveforms and standardize some of the derived parameters.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

ExoBand, A Passive Wearable Device as a Walking Aid in Neuromuscular Patients: First Quantitative Assessment.

Objective: Exoband (by Moveo, Padova, Italy) functions as a walking brace, comprising a belt and two leg loops connected by a mechanism that stores energy during the initial phase of the gait cycle and releases it in the subsequent phase. This enhances hip flexor thrust, leading to functional improvement in walking for individuals with conditions characterized by proximal weakness. It has been approved as a passive wearable device for individuals with impaired walking abilities. Objective of this study was to establish a protocol to assess the use of Exoband in patients with various neuromuscular disorders. Methods: This exploratory retrospective study includes consecutive patients diagnosed with neuromuscular disorders (CIDP, motor polyneuropathy, MND), exhibiting a proximal involvement and gait abnormalities. The evaluation protocol incorporated specific walking-related outcome measures, the 10-meter walk test (10mWT), Time-up-and-go test (TUG), and 2-minute walking test (2MWT). The assessments were conducted both with and without the Exoband under standard conditions. Results: Eight patients (6 males, aged 60-78 years) were tested. An increase in velocity was observed in the 10mWT (median 13.4 sec, IQR 12.0-15.7 vs. 12.2 sec, IQR 11.3-14.2 seconds, p < 0.05) and the TUG (14.0 sec, IQR 13-16.2 vs 13.35 sec, IQR 11-13.8; p < 0.05, by non-parametric Wilcoxon test), and a trend of increase in 2MWT (median 88.2 vs 92.6 m, n.s.). Six out of 8 patients reported subjective benefits from the very first use, including improved walking stability, speed, confidence, and reduced fatigue. Conclusions: Our protocol provides a quantitative assessment of Exoband usefulness for patients affected by neuropathies with gait abnormalities. Further investigations are warranted to assess the long-term effects of its regular Exoband use, its efficacy in specific neuromuscular diseases, and its potential role as a rehabilitation device.

Neuromuscular problems of the critically Ill neonate and child.

Acute neuromuscular disorders occasionally occur in the Pediatric Neurologic Intensive Care Unit. Many of these are primary disorders of the motor unit that may present acutely or exacerbate during an intercurrent illness. Additionally, acute neuromuscular disorders may develop during an acute systemic illness requiring intensive care management that predispose the child to another set of acute motor unit disorders. This chapter discusses acute neuromuscular crises in the infant, toddler, and adolescent, as well as neuromuscular disorders resulting from critical illness.

Psychosocial resources and psychopathology among persons with neuromuscular disorders during the COVID-19 pandemic.

BACKGROUND: The COVID-19 pandemic substantially affected the lives of persons with inherited neuromuscular disorders (INMD), causing disruption in clinical and support services. While several studies have investigated mental health, distress and psychosocial resources in the general population during the pandemic, little is known about the experience of persons with INMD. METHODS: This study was aimed to fill this gap by jointly investigating both psychopathological symptoms and psychosocial resources - specifically, resilience and perceived social support - among persons with INMD during the pandemic, taking into account demographic and clinical factors. Between April and December 2020, 59 participants with INMD (aged 15-59, 71.2% M) completed a questionnaire collecting demographic and clinical data, the Multidimensional Scale of Perceived Social Support, the Resilience Scale for Adults, and the Achenbach System of Empirically Based Assessment. RESULTS: Overall, participants showed good levels of resilience and perceived social support. A minority of participants reported clinically relevant psychopathological symptoms, 28.81% for anxiety and depression. Most psychopathological symptoms were negatively correlated with resilience (-0.347 < r < - .420), but not significantly associated with social support. Consistent with previous studies, regression analyses highlighted that participants with Duchenne muscular dystrophy were more prone to report anxious and depressive symptoms (B = 1.748, p = .028, OR = 5.744), and participants with myotonic dystrophy, attention problems (B = 2.339, p = .006, OR = 10.376). Resilience emerged as a potential predictor of lower anxious-depressive symptoms (B=-1.264, p = .012, OR = 0.283). CONCLUSIONS: The findings suggest the importance to investigate psychosocial resources in addition to psychopathology among persons with INMD, and to design interventions supporting resilience as a protective factor for mental health promotion.

Evaluation of Neuromuscular Diseases and Complaints by Quantitative Muscle MRI.

Background: Quantitative muscle MRI (qMRI) is a promising tool for evaluating and monitoring neuromuscular disorders (NMD). However, the application of different imaging protocols and processing pipelines restricts comparison between patient cohorts and disorders. In this qMRI study, we aim to compare dystrophic (limb-girdle muscular dystrophy), inflammatory (inclusion body myositis), and metabolic myopathy (Pompe disease) as well as patients with post-COVID-19 conditions suffering from myalgia to healthy controls. Methods: Ten subjects of each group underwent a 3T lower extremity muscle MRI, including a multi-echo, gradient-echo, Dixon-based sequence, a multi-echo, spin-echo (MESE) T2 mapping sequence, and a spin-echo EPI diffusion-weighted sequence. Furthermore, the following clinical assessments were performed: Quick Motor Function Measure, patient questionnaires for daily life activities, and 6-min walking distance. Results: Different involvement patterns of conspicuous qMRI parameters for different NMDs were observed. qMRI metrics correlated significantly with clinical assessments. Conclusions: qMRI metrics are suitable for evaluating patients with NMD since they show differences in muscular involvement in different NMDs and correlate with clinical assessments. Still, standardisation of acquisition and processing is needed for broad clinical use.

Casimersen (AMONDYS 45™): An Antisense Oligonucleotide for Duchenne Muscular Dystrophy.

Casimersen (AMONDYS 45TM) is an antisense oligonucleotide of the phosphorodiamidate morpholino oligomer subclass developed by Sarepta therapeutics. It was approved by the Food and Drug Administration (FDA) in February 2021 to treat Duchenne muscular dystrophy (DMD) in patients whose DMD gene mutation is amenable to exon 45 skipping. Administered intravenously, casimersen binds to the pre-mRNA of the DMD gene to skip a mutated region of an exon, thereby producing an internally truncated yet functional dystrophin protein in DMD patients. This is essential in maintaining the structure of a myocyte membrane. While casimersen is currently continuing in phase III of clinical trials in various countries, it was granted approval by the FDA under the accelerated approval program due to its observed increase in dystrophin production. This article discusses the pathophysiology of DMD, summarizes available treatments thus far, and provides a full drug review of casimersen (AMONDYS 45TM).

A comparison of peak cough flow and peak expiratory flow in children with neuromuscular disorders.

Spirometry and peak cough flow testing (PCF) are commonly used in the respiratory assessment of children with a neuromuscular disorder (NMD). Testing uses two different machines, increases laboratory time, costs and resource utilisation. No studies have assessed the correlation between peak expiratory flow (PEF) obtained from spirometry and PCF in children with NMD using one device. An audit of children with a NMD managed at the Children's Hospital at Westmead in 2022-2024 aged < 20 years who performed spirometry and PCF testing on the same device (Vyaire Body BoxTM, Ultrasonic flow meter-based, or Vyaire PneumotachographTM, Pneumotach flow meter-based; Germany) was conducted to assess the correlation between PCF and PEF. Fifty-one sets of testing were identified, and 40 subjects (9F) had reproducible testing and were included. Median (range) age was 14.95 (7.20-19.00) years. Median PEF (L/min) was 4.05 (1.22-10.26) and median PCF (L/min) was 4.29 (1.69-10.82). PEF and PCF had a strong Pearson's correlation coefficient, (R = 0.97, p = 0.03). The coefficient of determination was 0.93. If laboratory resources permit, spirometry should be the test of choice for children with NMD. On average, spirometry required multiple practices to achieve reproducibility to meet ATS/ERS standards. PCF testing can be utilised for children where performing technically acceptable spirometry is not possible.

Promising therapies for the treatment of myasthenia gravis.

INTRODUCTION: Myasthenia gravis (MG) is an autoimmune condition targeting the neuromuscular junction, which manifests with neuromuscular symptoms of varying severity and significant morbidity. The mainstay of treatment in MG is mitigation of the immune cascade with steroids and non-steroidal immunosuppressive therapies. The therapeutic strategies in MG are transitioning from broad and indiscriminate immunosuppression to novel agents targeting key steps in MG pathogenesis, including T cell activation, B cell proliferation, complement activation, maintenance of pathogenic antibody production, and proinflammatory cytokine production. AREAS COVERED: In this review, an overview of the pathogenesis of MG and traditional MG therapies is presented, followed by a discussion of the novel MG drugs that have been evaluated in phase 3 clinical trials with an emphasis on those which have received regulatory approval. EXPERT OPINION: Novel MG therapeutics belonging to the classes of complement inhibitors, neonatal Fc receptor (FcRn) inhibitors and B cell depletors, as well as the other emerging MG drugs in the pipeline constitute promising treatment strategies with potentially better efficacy and safety compared to the conventional MG treatments. However, further long-term research is needed in order to optimize the implementation of these new treatment options for the appropriate patient populations.

Qualitative feedback from caregivers in a multidisciplinary pediatric neuromuscular clinic.

OBJECTIVE: This study explored family satisfaction and perceived quality of care in a pediatric neuromuscular care clinic to assess the value of the multidisciplinary clinic (MDC) model in delivering coordinated care to children with neuromuscular disorders, such as cerebral palsy. METHODS: Caregivers of 22 patients were administered a qualitative survey assessing their perceptions of clinic efficiency, care coordination, and communication. Surveys were audio-recorded and transcribed. Thematic analysis was completed using both deductive and inductive methods. RESULTS: All caregivers reported that providers adequately communicated next steps in the patient's care, and most reported high confidence in caring for the patient as a result of the clinic. Four major themes were identified from thematic analysis: Care Delivery, Communication, Care Quality, and Family-Centeredness. Caregivers emphasized that the MDC model promoted access to care, enhanced efficiency, promoted provider teamwork, and encouraged shared care planning. Caregivers also valued a physical environment that was suitable for patients with complex needs. CONCLUSION: This study demonstrated that caregivers believed the MDC model was both efficient and convenient for pediatric patients with neuromuscular disorders. This model has the potential to streamline medical care and can be applied more broadly to improve care coordination for children with medical complexity.

Causal relationship between the immune phenotype of monocytes and myasthenia gravis: A Mendelian randomization study.

Background: Monocytes play an essential role in developing autoimmune diseases; however, their association with myasthenia gravis (MG) development is unclear. Methods: We performed a two-sample Mendelian randomization analysis to assess the causal relationship between monocyte-associated traits and MG, reviewing summary statistics of genome-wide association studies (GWAS). Results: Using the inverse variance weighted method, the following were found to be causally associated with MG: HLA-DR on monocytes (OR, 1.363; 95% CI, 1.158-1.605; P = 2E-04), HLA-DR on CD14+ monocytes (OR, 1.324; 95% CI, 1.183-1.482; P = 1.08E-06), HLA-DR on CD14+CD16- monocytes (OR, 1.313; 95% CI, 1.177-1.465; P = 1.07E-06), CD40 on monocytes (OR, 1.135; 95% CI, 1.012-1.272; P < 0.05), CD40 on CD14+CD16- monocytes (OR, 1.142; 95% CI, 1.015-1.285; P < 0.05), CD40 on CD14+CD16+ monocytes (OR, 1.142; 95% CI, 1.021-1.278; P < 0.05), CD64 on CD14+CD16+ monocytes (OR, 1.286; 95% CI, 1.019-1.623; P < 0.05). Conclusions: The present study suggests a causal relationship between the upregulation of CD40, HLA-DR, and CD64 on monocytes and the development of MG. Altered monocyte function may potentially be a risk factor for MG and a therapeutic target.