On topology and knotty entanglement in protein folding.

We investigate aspects of topology in protein folding. For this we numerically simulate the temperature driven folding and unfolding of the slipknotted archaeal virus protein AFV3-109. Due to knottiness the (un)folding is a topological process, it engages the entire backbone in a collective fashion. Accordingly we introduce a topological approach to model the process. Our simulations reveal that the (un)folding of AFV3-109 slipknot proceeds through a folding intermediate that has the topology of a trefoil knot. We observe that the final slipknot causes a slight swelling of the folded AFV3-109 structure. We disclose the relative stability of the strands and helices during both the folding and unfolding processes. We confirm results from previous studies that pointed out that it can be very demanding to simulate the formation of knotty self-entanglement, and we explain how the problems are circumvented: The slipknotted AFV3-109 protein is a very slow folder with a topologically demanding pathway, which needs to be properly accounted for in a simulation description. When we either increase the relative stiffness of bending, or when we decrease the speed of ambient cooling, the rate of slipknot formation rapidly increases.

Model for a novel membrane envelope in a filamentous hyperthermophilic virus.

Biological membranes create compartments, and are usually formed by lipid bilayers. However, in hyperthermophilic archaea that live optimally at temperatures above 80°C the membranes are monolayers which resemble fused bilayers. Many double-stranded DNA viruses which parasitize such hosts, including the filamentous virus AFV1 of Acidianus hospitalis, are enveloped with a lipid-containing membrane. Using cryo-EM, we show that the membrane in AFV1 is a ~2 nm-thick monolayer, approximately half the expected membrane thickness, formed by host membrane-derived lipids which adopt a U-shaped 'horseshoe' conformation. We hypothesize that this unusual viral envelope structure results from the extreme curvature of the viral capsid, as 'horseshoe' lipid conformations favor such curvature and host membrane lipids that permit horseshoe conformations are selectively recruited into the viral envelope. The unusual envelope found in AFV1 also has many implications for biotechnology, since this membrane can survive the most aggressive conditions involving extremes of temperature and pH.

Acidianus Tailed Spindle Virus: a New Archaeal Large Tailed Spindle Virus Discovered by Culture-Independent Methods.

UNLABELLED: The field of viral metagenomics has expanded our understanding of viral diversity from all three domains of life (Archaea, Bacteria, and Eukarya). Traditionally, viral metagenomic studies provide information about viral gene content but rarely provide knowledge about virion morphology and/or cellular host identity. Here we describe a new virus, Acidianus tailed spindle virus (ATSV), initially identified by bioinformatic analysis of viral metagenomic data sets from a high-temperature (80°C) acidic (pH 2) hot spring located in Yellowstone National Park, followed by more detailed characterization using only environmental samples without dependency on culturing. Characterization included the identification of the large tailed spindle virion morphology, determination of the complete 70.8-kb circular double-stranded DNA (dsDNA) viral genome content, and identification of its cellular host. Annotation of the ATSV genome revealed a potential three-domain gene product containing an N-terminal leucine-rich repeat domain, followed by a likely posttranslation regulatory region consisting of high serine and threonine content, and a C-terminal ESCRT-III domain, suggesting interplay with the host ESCRT system. The host of ATSV, which is most closely related to Acidianus hospitalis, was determined by a combination of analysis of cellular clustered regularly interspaced short palindromic repeat (CRISPR)/Cas loci and dual viral and cellular fluorescence in situ hybridization (viral FISH) analysis of environmental samples and confirmed by culture-based infection studies. This work provides an expanded pathway for the discovery, isolation, and characterization of new viruses using culture-independent approaches and provides a platform for predicting and confirming virus hosts. IMPORTANCE: Virus discovery and characterization have been traditionally accomplished by using culture-based methods. While a valuable approach, it is limited by the availability of culturable hosts. In this research, we report a virus-centered approach to virus discovery and characterization, linking viral metagenomic sequences to a virus particle, its sequenced genome, and its host directly in environmental samples, without using culture-dependent methods. This approach provides a pathway for the discovery, isolation, and characterization of new viruses. While this study used an acidic hot spring environment to characterize a new archaeal virus, Acidianus tailed spindle virus (ATSV), the approach can be generally applied to any environment to expand knowledge of virus diversity in all three domains of life.

Solution structure of an archaeal DNA binding protein with an eukaryotic zinc finger fold.

While the basal transcription machinery in archaea is eukaryal-like, transcription factors in archaea and their viruses are usually related to bacterial transcription factors. Nevertheless, some of these organisms show predicted classical zinc fingers motifs of the C2H2 type, which are almost exclusively found in proteins of eukaryotes and most often associated with transcription regulators. In this work, we focused on the protein AFV1p06 from the hyperthermophilic archaeal virus AFV1. The sequence of the protein consists of the classical eukaryotic C2H2 motif with the fourth histidine coordinating zinc missing, as well as of N- and C-terminal extensions. We showed that the protein AFV1p06 binds zinc and solved its solution structure by NMR. AFV1p06 displays a zinc finger fold with a novel structure extension and disordered N- and C-termini. Structure calculations show that a glutamic acid residue that coordinates zinc replaces the fourth histidine of the C2H2 motif. Electromobility gel shift assays indicate that the protein binds to DNA with different affinities depending on the DNA sequence. AFV1p06 is the first experimentally characterised archaeal zinc finger protein with a DNA binding activity. The AFV1p06 protein family has homologues in diverse viruses of hyperthermophilic archaea. A phylogenetic analysis points out a common origin of archaeal and eukaryotic C2H2 zinc fingers.

Structure and function of AvtR, a novel transcriptional regulator from a hyperthermophilic archaeal lipothrixvirus.

The structural and functional analysis of the protein AvtR encoded by Acidianus filamentous virus 6 (AFV6), which infects the archaeal genus Acidianus, revealed its unusual structure and involvement in transcriptional regulation of several viral genes. The crystal structure of AvtR (100 amino acids) at 2.6-Å resolution shows that it is constituted of a repeated ribbon-helix-helix (RHH) motif, which is found in a large family of bacterial transcriptional regulators. The known RHH proteins form dimers that interact with DNA using their ribbon to create a central ß-sheet. The repeated RHH motifs of AvtR superpose well on such dimers, but its central sheet contains an extra strand, suggesting either conformational changes or a different mode of DNA binding. Systematic evolution of ligands by exponential enrichment (SELEX) experiments combined with systematic mutational and computational analysis of the predicted site revealed 8 potential AvtR targets in the AFV6 genome. Two of these targets were studied in detail, and the complex role of AvtR in the transcriptional regulation of viral genes was established. Repressing transcription from its own gene, gp29, AvtR can also act as an activator of another gene, gp30. Its binding sites are distant from both genes' TATA boxes, and the mechanism of AvtR-dependent regulation appears to include protein oligomerization starting from the protein's initial binding sites. Many RHH transcriptional regulators of archaeal viruses could share this regulatory mechanism.

Crystal structure of ATV(ORF273), a new fold for a thermo- and acido-stable protein from the Acidianus two-tailed virus.

Acidianus two-tailed virus (ATV) infects crenarchaea of the genus Acidianus living in terrestrial thermal springs at extremely high temperatures and low pH. ATV is a member of the Bicaudaviridae virus family and undergoes extra-cellular development of two tails, a process that is unique in the viral world. To understand this intriguing phenomenon, we have undertaken structural studies of ATV virion proteins and here we present the crystal structure of one of these proteins, ATV(ORF273). ATV(ORF273) forms tetramers in solution and a molecular envelope is provided for the tetramer, computed from small-angle X-ray scattering (SAXS) data. The crystal structure has properties typical of hyperthermostable proteins, including a relatively high number of salt bridges. However, the protein also exhibits flexible loops and surface pockets. Remarkably, ATV(ORF273) displays a new α + ß protein fold, consistent with the absence of homologues of this protein in public sequence databases.

Genomic analysis of Acidianus hospitalis W1 a host for studying crenarchaeal virus and plasmid life cycles.

The Acidianus hospitalis W1 genome consists of a minimally sized chromosome of about 2.13 Mb and a conjugative plasmid pAH1 and it is a host for the model filamentous lipothrixvirus AFV1. The chromosome carries three putative replication origins in conserved genomic regions and two large regions where non-essential genes are clustered. Within these variable regions, a few orphan orfB and other elements of the IS200/607/605 family are concentrated with a novel class of MITE-like repeat elements. There are also 26 highly diverse vapBC antitoxin-toxin gene pairs proposed to facilitate maintenance of local chromosomal regions and to minimise the impact of environmental stress. Complex and partially defective CRISPR/Cas/Cmr immune systems are present and interspersed with five vapBC gene pairs. Remnants of integrated viral genomes and plasmids are located at five intron-less tRNA genes and several non-coding RNA genes are predicted that are conserved in other Sulfolobus genomes. The putative metabolic pathways for sulphur metabolism show some significant differences from those proposed for other Acidianus and Sulfolobus species. The small and relatively stable genome of A. hospitalis W1 renders it a promising candidate for developing the first Acidianus genetic systems.

Chaperone role for proteins p618 and p892 in the extracellular tail development of Acidianus two-tailed virus.

The crenarchaeal Acidianus two-tailed virus (ATV) undergoes a remarkable morphological development, extracellularly and independently of host cells, by growing long tails at each end of a spindle-shaped virus particle. Initial work suggested that an intermediate filament-like protein, p800, is involved in this process. We propose that an additional chaperone system is required, consisting of a MoxR-type AAA ATPase (p618) and a von Willebrand domain A (VWA)-containing cochaperone, p892. Both proteins are absent from the other known bicaudavirus, STSV1, which develops a single tail intracellularly. p618 exhibits ATPase activity and forms a hexameric ring complex that closely resembles the oligomeric complex of the MoxR-like protein RavA (YieN). ATV proteins p387, p653, p800, and p892 interact with p618, and with the exception of p800, all bind to DNA. A model is proposed to rationalize the interactions observed between the different protein and DNA components and to explain their possible structural and functional roles in extracellular tail development.

ORF157 from the archaeal virus Acidianus filamentous virus 1 defines a new class of nuclease.

Acidianus filamentous virus 1 (AFV1) (Lipothrixviridae) is an enveloped filamentous virus that was characterized from a crenarchaeal host. It infects Acidianus species that thrive in the acidic hot springs (>85 degrees C and pH <3) of Yellowstone National Park, WY. The AFV1 20.8-kb, linear, double-stranded DNA genome encodes 40 putative open reading frames whose sequences generally show little similarity to other genes in the sequence databases. Because three-dimensional structures are more conserved than sequences and hence are more effective at revealing function, we set out to determine protein structures from putative AFV1 open reading frames (ORF). The crystal structure of ORF157 reveals an alpha+beta protein with a novel fold that remotely resembles the nucleotidyltransferase topology. In vitro, AFV1-157 displays a nuclease activity on linear double-stranded DNA. Alanine substitution mutations demonstrated that E86 is essential to catalysis. AFV1-157 represents a novel class of nuclease, but its exact role in vivo remains to be determined.

Acidianus filamentous virus 1 coat proteins display a helical fold spanning the filamentous archaeal viruses lineage.

Acidianus filamentous virus 1 (AFV1), a member of the Lipothrixviridae family, infects the hyperthermophilic, acidophilic crenarchaeaon Acidianus hospitalis. The virion, covered with a lipidic outer shell, is 9,100-A long and contains a 20.8-kb linear dsDNA genome. We have identified the two major coat proteins of the virion (MCPs; 132 and 140 amino acids). They bind DNA and form filaments when incubated with linear dsDNA. A C-terminal domain is identified in their crystal structure with a four-helix-bundle fold. In the topological model of the virion filament core, the genomic dsDNA superhelix wraps around the AFV1-132 basic protein, and the AFV1-140 basic N terminus binds genomic DNA, while its lipophilic C-terminal domain is imbedded in the lipidic outer shell. The four-helix bundle fold of the MCPs from AFV1 is identical to that of the coat protein (CP) of Sulfolobus islandicus rod-shaped virus (SIRV), a member of the Rudiviridae family. Despite low sequence identity between these proteins, their high degree of structural similarity suggests that they could have derived from a common ancestor and could thus define an yet undescribed viral lineage.

The thermo- and acido-stable ORF-99 from the archaeal virus AFV1.

Acidianus Filamentous Virus 1 (AFV1), isolated from acidic hot springs, is an enveloped lipid-containing archaeal filamentous virus with a linear double-stranded DNA genome. It infects Acidianus, which is a hyperthermostable archaea growing at 85 degrees C and acidic pHs, below pH 3. AFV1-99, a protein of 99 amino acids of unknown function, has homologues in the archaeal virus families Lipothrixviridae and Rudiviridae. We determined the crystal structure of AFV1-99 at 2.05 A resolution. AFV1-99 has a new fold, is hyperthermostable (up to 95 degrees C) and resists to extreme pH (between pH 0 and 11) and to the combination of high temperature (95 degrees C) and low pH (pH 0). It possesses characteristics of hyperthermostable proteins, such as a high content of charged residues.

Crystal structure of AFV1-102, a protein from the acidianus filamentous virus 1.

Viruses infecting hyperthermophilic archaea have intriguing morphologies and genomic properties. The vast majority of their genes do not have homologs other than in other hyperthermophilic viruses, and the biology of these viruses is poorly understood. As part of a structural genomics project on the proteins of these viruses, we present here the structure of a 102 amino acid protein from acidianus filamentous virus 1 (AFV1-102). The structure shows that it is made of two identical motifs that have poor sequence similarity. Although no function can be proposed from structural analysis, tight binding of the gateway tag peptide in a groove between the two motifs suggests AFV1-102 is involved in protein protein interactions.

Novel archaeal plasmid pAH1 and its interactions with the lipothrixvirus AFV1.

At present very little is known about interactions between extrachromosomal genetic elements in Archaea. Here we describe an Acidianus strain which carries naturally a novel 28 kb conjugative plasmid-like element, pAH1, and also serves as a laboratory host for lipothrixvirus AFV1. In an attempt to establish a system for studying plasmid-virus interactions we characterized the genome of pAH1 which closely resembles those of the Sulfolobus conjugative plasmids pARN3 and pARN4. pAH1 integrates site specifically into, and excises from, the host chromosome indicating a dynamic interaction with the latter. Although nucleotide sequence comparisons revealed extensive intergenomic exchange during the evolution of archaeal conjugative plasmids, pAH1 was shown to be stably maintained suggesting that the host system is suitable for studying plasmid-virus interactions. AFV1 infection and propagation leads to a loss of the circular form of pAH1 and this effect correlates positively with the increase in the intracellular quantity of AFV1 DNA. We infer that the virus inhibits plasmid replication since no pAH1 degradation was observed. This mechanism of archaeal viral inhibition of plasmid propagation is not observed in bacteria where relevant bacteriophages either are dependent on a conjugative plasmid for successful infection or are excluded by a resident plasmid.

Viruses in acidic geothermal environments of the Kamchatka Peninsula.

Screening for viruses in samples taken from acidic hot springs of Kamchatka (Russia) revealed a collection of morphotypes, including linear, spherical and complex fusiform shapes, which show partial similarity to those found in acidic geothermal environments in other geographical locations. One of the viruses, Acidianus filamentous virus 9, AFV9, was isolated and its structure and genome were studied in detail.

Structure of the acidianus filamentous virus 3 and comparative genomics of related archaeal lipothrixviruses.

Four novel filamentous viruses with double-stranded DNA genomes, namely, Acidianus filamentous virus 3 (AFV3), AFV6, AFV7, and AFV8, have been characterized from the hyperthermophilic archaeal genus Acidianus, and they are assigned to the Betalipothrixvirus genus of the family Lipothrixviridae. The structures of the approximately 2-mum-long virions are similar, and one of them, AFV3, was studied in detail. It consists of a cylindrical envelope containing globular subunits arranged in a helical formation that is unique for any known double-stranded DNA virus. The envelope is 3.1 nm thick and encases an inner core with two parallel rows of protein subunits arranged like a zipper. Each end of the virion is tapered and carries three short filaments. Two major structural proteins were identified as being common to all betalipothrixviruses. The viral genomes were sequenced and analyzed, and they reveal a high level of conservation in both gene content and gene order over large regions, with this similarity extending partly to the earlier described betalipothrixvirus Sulfolobus islandicus filamentous virus. A few predicted gene products of each virus, in addition to the structural proteins, could be assigned specific functions, including a putative helicase involved in Holliday junction branch migration, a nuclease, a protein phosphatase, transcriptional regulators, and glycosyltransferases. The AFV7 genome appears to have undergone intergenomic recombination with a large section of an AFV2-like viral genome, apparently resulting in phenotypic changes, as revealed by the presence of AFV2-like termini in the AFV7 virions. Shared features of the genomes include (i) large inverted terminal repeats exhibiting conserved, regularly spaced direct repeats; (ii) a highly conserved operon encoding the two major structural proteins; (iii) multiple overlapping open reading frames, which may be indicative of gene recoding; (iv) putative 12-bp genetic elements; and (v) partial gene sequences corresponding closely to spacer sequences of chromosomal repeat clusters.

Genome of the Acidianus bottle-shaped virus and insights into the replication and packaging mechanisms.

The Acidianus bottle-shaped virus, ABV, infects strains of the hyperthermophilic archaeal genus Acidianus and is morphologically distinct from all other known viruses. Its genome consists of linear double-stranded DNA, containing 23,814 bp with a G+C content of 35%, and it exhibits a 590-bp inverted terminal repeat. Of the 57 predicted ORFs, only three produced significant matches in public sequence databases with genes encoding a glycosyltransferase, a thymidylate kinase and a protein-primed DNA polymerase. Moreover, only one homologous gene is shared with other sequenced crenarchaeal viruses. The results confirm the unique nature of the ABV virus, and support its assignment to the newly proposed viral family the Ampullaviridae. Exceptionally, one region at the end of the linear genome of ABV is similar in both gene content and organization to corresponding regions in the genomes of the bacteriophage varphi29 and the human adenovirus. The region contains the genes for a putative protein-primed DNA polymerase, and a small putative RNA with a predicted secondary structure closely similar to that of the prohead RNA of bacteriophage varphi29. The apparent similarities in the putative mechanisms of DNA replication and packaging of ABV to those of bacterial and eukaryal viruses are most consistent with the concept of a primordial gene pool as a source of viral genes.

Structural and genomic properties of the hyperthermophilic archaeal virus ATV with an extracellular stage of the reproductive cycle.

A novel virus, ATV, of the hyperthermophilic archaeal genus Acidianus has the unique property of undergoing a major morphological development outside of, and independently of, the host cell. Virions are extruded from host cells as lemon-shaped tail-less particles, after which they develop long tails at each pointed end, at temperatures close to that of the natural habitat, 85 degrees C. The extracellularly developed tails constitute tubes, which terminate in an anchor-like structure that is not observed in the tail-less particles. A thin filament is located within the tube, which exhibits a periodic structure. Tail development produces a one half reduction in the volume of the virion, concurrent with a slight expansion of the virion surface. The circular, double-stranded DNA genome contains 62,730 bp and is exceptional for a crenarchaeal virus in that it carries four putative transposable elements as well as genes, which previously have been associated only with archaeal self-transmissable plasmids. In total, it encodes 72 predicted proteins, including 11 structural proteins with molecular masses in the range of 12 to 90 kDa. Several of the larger proteins are rich in coiled coil and/or low complexity sequence domains, which are unusual for archaea. One protein, in particular P800, resembles an intermediate filament protein in its structural properties. It is modified in the two-tailed, but not in the tail-less, virion particles and it may contribute to viral tail development. Exceptionally for a crenarchaeal virus, infection with ATV results either in viral replication and subsequent cell lysis or in conversion of the infected cell to a lysogen. The lysogenic cycle involves integration of the viral genome into the host chromosome, probably facilitated by the virus-encoded integrase and this process can be interrupted by different stress factors.

Virology: independent virus development outside a host.

Viruses are thought to be functionally inactive once they are outside and independent of their host cell. Here we describe an exceptional property of a newly discovered virus that infects a hyperthermophilic archaeon growing in acidic hot springs: the lemon-shaped viral particle develops a very long tail at each of its pointed ends after being released from its host cell. The process occurs only at the temperature of the host's habitat (75-90 degrees C) and it does not require the presence of the host cell, an exogenous energy source or any cofactors. This host-independent morphological development may be a strategy for viral survival in an environment that is unusually harsh and has limited host availability.

Viral diversity in hot springs of Pozzuoli, Italy, and characterization of a unique archaeal virus, Acidianus bottle-shaped virus, from a new family, the Ampullaviridae.

Virus-like particles with five different morphotypes were observed in an enriched environmental sample from a hot, acidic spring (87 to 93 degrees C, pH 1.5) in Pozzuoli, Italy. The morphotypes included rigid rods, flexible filaments, and novel, exceptional forms. Particles of each type were isolated, and they were shown to represent viable virions of five novel viruses which infect members of the hyperthermophilic archaeal genus Acidianus. One of these, named the Acidianus bottle-shaped virus, ABV, exhibits a previously unreported morphotype. The bottle-shaped virion carries an envelope which encases a funnel-shaped core. The pointed end of the virion is likely to be involved in adsorption and channeling of viral DNA into host cells. The broad end exhibits 20 (+/- 2) thin filaments which appear to be inserted into a disk, or ring, and are interconnected at their bases. These filaments are apparently not involved in adsorption. ABV virions contain six proteins in the size range 15 to 80 kDa and a 23.9-kb linear, double-stranded DNA genome. Virus replication does not cause lysis of host cells. On the basis of its unique morphotype and structure, we propose to assign ABV to a new viral family, the Ampullaviridae.

A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus.

Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 +/- 50 nm long and 22 +/- 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.