Reducing Unnecessary Respiratory Viral Testing to Promote High-Value Care.

BACKGROUND AND OBJECTIVES: Viral respiratory infections are common in children, and practice guidelines do not recommend routine testing for typical viral illnesses. Despite results often not impacting care, nasopharyngeal swabs for viral testing are frequently performed and are an uncomfortable procedure. The aim of this initiative was to decrease unnecessary respiratory viral testing (RVT) in the emergency department (ED) and the pediatric medicine wards (PMWs) by 50% and 25%, respectively, over 36 months. METHODS: An expert panel reviewed published guidelines and appropriate evidence to formulate an RVT pathway using plan-do-study-act cycles. A multifaceted improvement strategy was developed that included implementing 2 newer, more effective tests when testing was deemed necessary; electronic order modifications with force functions; audit and feedback; and education. By using statistical process control charts, the outcomes analyzed were the percentage of RVT ordered in the ED and the rate of RVT ordered on the PMWs. Balancing measures included return visits leading to admission and inpatient viral nosocomial outbreaks. RESULTS: The RVT rate decreased from a mean of 3.0% to 0.5% of ED visits and from 44.3 to 30.1 per 1000 patient days on the PMWs and was sustained throughout the study. Even when accounting for the new rapid influenza test available in the ED, a 50% decrease in overall ED RVT was still achieved without any significant impact on return visits leading to admission or inpatient nosocomial infections. CONCLUSIONS: Through implementation of a standardized, electronically integrated RVT pathway, a decrease in unnecessary RVT was successfully achieved. Audit and feedback, reminders, and biannual education all supported long-term sustainability of this initiative.

Standardized preservation, extraction and quantification techniques for detection of fecal SARS-CoV-2 RNA.

Patients with COVID-19 shed SARS-CoV-2 RNA in stool, sometimes well after their respiratory infection has cleared. This may be significant for patient health, epidemiology, and diagnosis. However, methods to preserve stool, and to extract and quantify viral RNA are not standardized. We test the performance of three preservative approaches at yielding detectable SARS-CoV-2 RNA: the OMNIgene-GUT kit, Zymo DNA/RNA shield kit, and the most commonly applied, storage without preservative. We test these in combination with three extraction kits: QIAamp Viral RNA Mini Kit, Zymo Quick-RNA Viral Kit, and MagMAX Viral/Pathogen Kit. We also test the utility of ddPCR and RT-qPCR for the reliable quantification of SARS-CoV-2 RNA from stool. We identify that the Zymo DNA/RNA preservative and the QiaAMP extraction kit yield more detectable RNA than the others, using both ddPCR and RT-qPCR. Taken together, we recommend a comprehensive methodology for preservation, extraction and detection of RNA from SARS-CoV-2 and other coronaviruses in stool.

The Comparison of Honeybee Viral Loads for Six Honeybee Viruses (ABPV, BQCV, CBPV, DWV, LSV3 and SBV) in Healthy and Clinically Affected Honeybees with TaqMan Quantitative Real-Time RT-PCR Assays.

The viral loads of acute bee paralysis virus (ABPV), black queen cell virus (BQCV), chronic bee paralysis virus (CBPV), deformed wing virus (DWV), Lake Sinai virus 3 (LSV3), and sacbrood bee virus (SBV) were determined in samples with the use of quantitative TaqMan real-time reverse transcription and polymerase chain reaction (RT-qPCR). A total of 108 samples of healthy adult honeybees from four differently located apiaries and samples of honeybees showing different clinical signs of viral infections from 89 apiaries were collected throughout Slovenia. The aim of this study was to discover correlations between viral loads and clinical signs in adult honeybees and confirm previously set threshold viral load levels between healthy and clinically affected honeybees. Within this study, two new RT-qPCR assays for quantification of LSV3 and SBV were developed. Statistically significant differences in viral loads of positive samples were identified between healthy and clinically affected honeybees for ABPV, CBPV, DWV, and SBV, while for BQCV and LSV3, no statistical differences were observed between both groups. Despite high detected LSV3 prevalence and viral loads around 6.00 log10 viral copies/bee, this lineage probably has a limited impact on the health status of honeybee colonies. The determined viral loads between 3.94 log10 and 13.17 log10 in positive samples for six viruses, collected over 10 consecutive months, including winter, present additional information of high viral load variations in healthy honeybee colonies.

Evaluation of the Aptima HIV-1 Quant Dx assay for HIV diagnosis at birth in South Africa.

The increased coverage of antiretroviral therapy has resulted in a decrease in the positive predictive value (PPV) and diagnostic sensitivity of early infant diagnosis assays. To evaluate the diagnostic performance of the Aptima HIV-1 Quant DX assay (Aptima) in detecting HIV infection at birth. The study was a cross-sectional laboratory based evaluation using whole blood DBS specimens. Samples were collected from HIV-exposed neonates at birth at two paediatric facilities in Gauteng between 1st March 2018 - 31st January 2020. Performance of the Aptima compared to the Cobas® AmpliPrep/Cobas® TaqMan HIV-1 Qualitative Test v2.0 was calculated using a two-by-two table and reported as proportions with 95% confidence intervals. A total of 363 infants met the inclusion criteria of which 4 (1.1%) had an Aptima result discordant with CAP/CTM HIV status: two (50%) negative and two (50%) positive. The Aptima assay had a sensitivity of 93.75% (95% CI: 79.19%-99.23%), specificity of 99.4% (95% CI: 97.83%-99.93%), PPV of 93.75% (95% CI: 78.98%-98.36%), negative predictive value of 99.4% (95% CI: 97.73%-99.84%), and overall accuracy of 98.9% (95% CI: 97.2%-99.7%). The Aptima yielded an error code on 37 (10.19%) results, of which 35 (94.59%) were resolved on repeat testing. Of the 32 HIV-detected specimens, 20 had a plasma VL result available (18 on Abbott and 2 on Cobas). The absolute median difference was 0.66 log10 (IQR: 0.36-1.71). The Aptima demonstrated good EID performance and can be considered as a qualitative EID assay.

Severe Acute Respiratory Syndrome Coronavirus 2 Normalized Viral Loads and Subgenomic RNA Detection as Tools for Improving Clinical Decision Making and Work Reincorporation.

BACKGROUND: Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) reverse-transcription polymerase chain reaction (RT-PCR) provides a highly variable cycle threshold (Ct) value that cannot distinguish viral infectivity. Subgenomic ribonucleic acid (sgRNA) has been used to monitor active replication. Given the importance of long RT-PCR positivity and the need for work reincorporation and discontinuing isolation, we studied the functionality of normalized viral loads (NVLs) for patient monitoring and sgRNA for viral infectivity detection. METHODS: The NVLs measured through the Nucleocapsid and RNA-dependent-RNA-polymerase genes and sgRNA RT-PCRs were performed in 2 consecutive swabs from 84 healthcare workers. RESULTS: The NVLs provided similar and accurate quantities of both genes of SARS-CoV-2 at 2 different timepoints of infection, overcoming Ct-value and swab collection variability. Among SARS-CoV-2-positive samples, 51.19% were sgRNA-positive in the 1st RT-PCR and 5.95% in the 2nd RT-PCR. All sgRNA-positive samples had >4 log10 RNA copies/1000 cells, whereas samples with ≤1 log10 NVLs were sgRNA-negative. Although NVLs were positive until 29 days after symptom onset, 84.1% of sgRNA-positive samples were from the first 7 days, which correlated with viral culture viability. Multivariate analyses showed that sgRNA, NVLs, and days of symptoms were significantly associated (P < .001). CONCLUSIONS: The NVLs and sgRNA are 2 rapid accessible techniques that could be easily implemented in routine hospital practice providing a useful proxy for viral infectivity and coronavirus disease 2019 patient follow-up.

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions.

BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

HIV-1 viral load testing in resource-limited settings: Challenges and solutions for specimen integrity.

HIV-1 viral load (VL) testing is a crucial element in providing an antiretroviral treatment monitoring program. The success of these programs depends on the availability and quality of the VL testing services. There are several pre-analytic factors which can affect the quality of VL testing. Many of the challenges faced by resource-limited countries result in a compromise of specimen integrity, thus limiting widespread access to VL monitoring. The various logistic and financial challenges that exist are not insurmountable and several innovative solutions currently exist to overcome these barriers to providing widespread VL testing. This review summarizes the VL testing challenges in resource-limited settings and provides an overview of potential solutions including testing dried blood spots, dried plasma spots, plasma separation cards and the use of point of care tests.

Real-world application of the Xpert® HBV viral load assay on serum and dried blood spots.

As we strive towards the WHO goal of elimination of viral hepatitis as a public health threat by 2030, implementation of reliable, accurate diagnostic assays is crucial to identify those at risk of disease progression and those at risk of transmission. Ironically those at greatest risk of chronic hepatitis B are often in resource-poor regions with limited access to testing, collection, storage, and/or transportation of peripheral blood. The Xpert® HBV Viral Load assay provides an easy to use, convenient means of measuring load on GeneXpert platforms. In this study, the Xpert assay is evaluated against four commercially available high-throughput assays for Hepatitis B virus (HBV) loads. In addition application of dried blood spots (DBS) for estimation of viral load is assessed on real-world samples collected from a remote Pacific Island, Kiribati. A total of 107 serum/plasma samples were tested in the Xpert HBV load assay and compared with the Abbott m2000, Alinity m, and Roche Cobas CAP/CTM and 6800. Fifty-three DBS were tested in the Xpert assay and compared with matching serum samples. Overall 82% serum/plasma samples demonstrated good correlation between the Xpert and Roche and Abbott assays, to within 0.5 log10 IU/ml. The greatest discrepancies were seen at the limits of quantification of all assays. About 85.4% DBS gave estimable viral loads to within 1 log10 IU/ml of the serum load. The Xpert HBV viral load assay is recommended for all settings but particularly useful for resource-poor settings. Utility of DBS with the Xpert assay provides a simple means for testing in remote settings.

Hock-a-loogie saliva as a diagnostic specimen for SARS-CoV-2 by a PCR-based assay: A diagnostic validity study.

To clarify the effect of different respiratory sample types on SARS-CoV-2 detection, we collected throat swabs, nasal swabs and hock-a-loogie saliva or sputum, and compared their detection rates and viral loads. The detection rates of sputum (95.65%, 22/23) and hock-a-loogie saliva (88.09%, 37/42) were significantly higher than those in throat swabs (41.54%, 27/65) and nasal swabs (72.31%, 47/65) (P < 0.001). The Ct Values of sputum, hock-a-loogie saliva and nasal swabs were significantly higher than that in throat swabs, whereas no significant difference was observed between sputum and saliva samples. Hock-a-loogie saliva are reliable sample types that can be used to detect SARS-CoV-2, and worthy of clinical promotion.

Use of synthetic oligonucleotides for determination of HTLV-1 proviral load by real-time PCR: a helpful alternative approach in the clinical management.

AIMS: To evaluate the potential use of synthetic oligonucleotides as a standard curve for proviral load (PVL) of human T-cell leukaemia virus type 1 (HTLV-1) quantification in peripheral blood mononuclear cells (PBMC) of HTLV-1-infected individuals by quantitative real-time polymerase chain reaction (qPCR) analysis. METHODS AND RESULTS: Synthetic oligonucleotides based on HTLV-1 genome were customized to use as a standard curve. Twelve anti-HTLV-1-positive samples with known HTLV-1 PVL, previously quantified by qPCR assay using TARL-2 cells as a conventional standard curve, were submitted to the new protocol. The proviral quantification levels had a high concordance with qPCR results using a conventional standard curve. The results demonstrate that the conventional standard curve can be replaced by a synthetic standard curve due to its ability to quantification based on the linearity and qPCR efficiency and similar results with a validated qPCR assay using a conventional standard curve. CONCLUSIONS: Synthetic oligonucleotides standard curves could be a very useful tool on HTLV-1 diagnosis and absolute HTLV-1 PVL quantification. SIGNIFICANCE AND IMPACT OF THE STUDY: HTLV-1 PVL determination using synthetic oligonucleotides standard curve by qPCR could be a helpful alternative for the laboratories that monitor infected patients as an important prognostic factor in HTLV-1-associated diseases progression. Also, it can decrease costs and overcome the biological limitations of the plasmid curve.

Development and evaluation of a time-saving RT-qRPA method for the detection of genotype 4 HEV presence in raw pork liver.

Hepatitis E virus (HEV) is a zoonotic pathogen spreading worldwide. Pig was known as its first and main animal reservoir. In China, pork consumption is very large and the risk of potential HEV contamination should not be underestimated. The present study aims to develop a quantitative real-time reverse transcription combining recombinase polymerase amplification assay (RT-qRPA) for the rapid detection of HEV RNA presence in raw pork liver on the Jinzhou markets in China. Methods: the specific primers and probes for RT-qRPA assay were designed targeting the ORF2/3 conserved region in genotype 4 swine HEV isolate (accession no. DQ279091.2) according to the TwistDx manual instructions. The specificity, sensitivity and reproducibility evaluations of the RT-qRPA method were subsequently conducted in assessing agreement with the standard RT-qPCR method. Results: the qRPA method step exhibited the obvious time-saving advantage which worked under the isothermal condition at 39 °C within about 30 min to complete the run while the compared standard qPCR method in the same cycle took almost 60 min to do. Both methods could exclusively detect the HEV genome equivalents from the quantified HEV-VLPs spiked samples. And both methods shared the same limit of detection (LOD) that was estimated at 1.25 × 103 genome equivalents copies/g spiked sample by the probit analysis. The recovery rate of HEV-VLPs reached a range of 9.56-14.65% by the RT-qRPA method which was higher than that of 1.34-2.34% by the standard RT-qPCR method. The detected HEV RNA positive rate in the field was 1.8% (1 out of 55) by both methods under Cohen's kappa statistic accessing with perfect agreement (κ = 1.00, p < 0.0005). The viral load in positive sample detected by the RT-qRPA method was estimated at 2.2125 × 105 genome copies/g pork liver sample. Conclusions, the present reported RT-qRPA method mainly targeting genotype 4 HEV is a rapid and reliable method. Its time-saving quality offers a promising for the development of a portable tool used in the routine monitoring of HEV contamination in the field.

Severe underquantification of HIV-1 group O isolates by major commercial PCR-based assays.

HIV-1 diversity poses major challenges to viral load assays because genetic polymorphisms can impede nucleic acid detection. In addition to the on-going viral diversification within the HIV-1 group M pandemic, HIV-1 genetic diversity is further increased by non-group M infections, such as HIV-1 groups O (HIV-1-O), N and P. We here conducted a systematic evaluation of commercially available PCR assays to detect HIV-1-O isolates. We collected 25 primary HIV-1-O isolates covering all genetic clusters within HIV-1-O. Subsequently, this panel of isolates was tested on eight commercially available quantitative and five qualitative HIV-1 PCR-based assays in serial dilutions. Sequence analyses were performed for severe cases of underquantification or lack of detection. We observed differences between the assays in quantification that depended on the HIV-1-O isolate's subgroup. All three tested HIV-1-O subgroup IV isolates were underquantified by the Roche CAP/CTM >800-fold compared to the Abbott RealTime assay. In contrast, the latter assay underquantified several subgroup I isolates >200-fold. Notably, the Xpert HIV-1 Viral Load test from Cepheid failed to detect two of the HIV-1-O isolates, whereas the Roche Cobas 8800 assay readily detected all isolates. Comparative sequence analyses identified polymorphisms in the HIV-1-O long-terminal repeat and integrase genes that likely underlie inadequate nucleic acid amplification. Potential viral load underquantification should be considered in therapeutic monitoring of HIV-1-O-infected patients. Pre-clinical assessments of HIV-1 diagnostic assays could be harmonized by establishing improved and internationally standardized panels of HIV-1 isolates that cover the dynamic diversity of circulating HIV-1 strains.

Performance evaluation of the Aptima HIV-1 Quant Dx assay for detection of HIV in infants in Kenya.

BACKGROUND: Early infant diagnosis (EID) of HIV-1 exposed infants enables timely initiation of antiretroviral therapy (ART), thereby allowing early diagnosis and treatment to slow disease progression and reduce mortality. Turn-around time to results, partially caused by low to medium throughput technology, remains a hindrance to early treatment. A major solution to this challenge is to incorporate high throughput and accurate technologies in the testing process. The Hologic Aptima Quant Dx Assay (Aptima) is a CE marked Real-Time TMA assay running on the high throughput Panther system. OBJECTIVES: The objective of this study was to evaluate the performance of Aptima for EID using dried blood spots. STUDY DESIGN: This was a cross-sectional prospective study of 2,048 infants seeking HIV services from health facilities in Western Kenya, Africa. Capillary Dried Blood Spot samples DBS were collected from infants with the consent of their mothers. The qualitative performance of Aptima was compared with the Roche COBAS Ampliprep/ COBAS Taqman HIV-1 Qualitative Test v2.0 (CAP/CTM), using these DBS. Demographic information of the participants was also collected. RESULTS: A total of 1,975 successful comparisons between the two platforms were included in the analysis. The overall agreement between the assays was 99.65 %. The sensitivity and specificity of Aptima was 95.24 % (95 % CI 88.40-98.19 %) and 99.84 % (95 % CI 99.49-99.92 %) respectively. CONCLUSIONS: Aptima assay has performance characteristics that are comparable to those of the Roche CAP/CTM for qualitative testing on DBS taken from infants. The two assays can therefore be used interchangeably for Early Infant Diagnosis of HIV.

Análisis de resultados del Programa de Control de Calidad Externo SEIMC de carga viral del VIH-1, VHC y VHB. Año 2017 / Analysis of the results of HIV-1, HCV and HBV viral loads of the SEIMC External Quality Control Programme. Year 2017

FUNDAMENTOS: Las determinaciones microbiológicas de la carga viral de los virus de la inmunodeficiencia humana tipo 1 (VIH-1), de la hepatitis C (VHC) y de la hepatitis B (VHB) son fundamentales para el seguimiento y control de los pacientes infectados por estos virus. Los laboratorios de microbiología disponen de herramientas que garantizan la fiabilidad de sus resultados, entre ellas se encuentran los programas de intercomparación externos, como es el Programa de Control de Calidad de la Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica (SEIMC). En el presente número se muestra el análisis de resultados del Programa de Control de Calidad SEIMC de carga viral de estos virus, incluyendo el genotipado del VHC, realizado durante el año 2017. MÉTODOS Y RESULTADOS: En el control de VIH-1 se remitieron 5 estándares, de los que uno (plasma humano seronegativo) no contenía el virus, y los otros 4 consistían en plasma de 3 pacientes virémicos distintos en un intervalo de concentraciones entre 2-5 log10 copias/ml. Una parte significativa de los laboratorios obtuvo de uno a varios resultados fuera de los límites aceptables (media ± 0,25 log10 copias/ml), dependiendo del estándar y del método empleado, en promedio el 35% de los centros. La repetibilidad fue buena, y más del 94% de los laboratorios obtuvieron resultados aceptables (D < 0,5 log10 copias/ml). En los controles de VHC y VHB se remitieron 2 estándares con diferente contenido del virus. La mayor parte de los participantes, un 82% en el caso del VHC y un 87% en el del VHB, obtuvo ambos resultados dentro de los límites de la media±1,96 DE log10 UI/ml. CONCLUSIONES: Los resultados obtenidos ponen de manifiesto la utilidad de los controles externos para asegurar la calidad de los resultados analíticos. Debido a la variabilidad interlaboratorio observada, es aconsejable utilizar el mismo método y laboratorio en el seguimiento de los pacientes

BACKGROUND: Human immunodeficiency virus type 1 (HIV-1) and hepatitis B (HBV) and C virus (HCV) viral load determinations are among the most relevant markers for the follow-up of patients infected with these viruses. External quality control tools are crucial to ensure the accuracy of the results obtained by microbiology laboratories. This article summarised the results obtained from the 2017 SEIMC External Quality Control Programme for HIV-1, HCV, and HBV viral loads and HCV genotyping. METHODS AND RESULTS: In the HIV-1 programme, a total of five standards were sent. One standard consisted of seronegative human plasma, while the remaining four contained plasma from three different viremic patients, in the range of 2-5 log10 copies/mL; two of these standards were identical, with the aim of determining repeatability. A significant proportion of the laboratories (35% on average) obtained values outside the accepted range (mean ± 0.25 log10 copies/mL), depending on the standard and on the method used for quantification. Repeatability was good, with up to 94% of laboratories reporting results within the limits (D < 0.5 log10 copies/mL). The HBV and HCV programme consisted of two standards with different viral load contents. Most of the participants, 82% in the case of HCV and 87% in that of HBV, obtained all the results within the accepted range (mean ± 1.96 SD log10 UI/mL). CONCLUSIONS: Data from this analysis reinforce the utility of proficiency programmes to ensure the quality of the results obtained by a particular laboratory. Due to the marked interlaboratory variability observed, it is advisable to use the same method and laboratory for patient follow-up

Análisis de resultados del Programa de Control de Calidad Externo SEIMC de carga viral del VIH-1, VHC y VHB. AÑO 2018 / Analysis of the results of HIV-1, HCV and HBV viral loads of the SEIMC External Quality Control Program. Year 2018

FUNDAMENTOS: Las determinaciones microbiológicas de la carga viral de los virus de la inmunodeficiencia humana tipo 1 (VIH-1), de la hepatitis C (VHC) y de la hepatitis B (VHB) son fundamentales para el seguimiento y control de los pacientes infectados por estos virus. Los laboratorios de microbiología disponen de herramientas que garantizan la fiabilidad de sus resultados, entre ellas se encuentran los programas de intercomparación externos, como el Programa de Control de Calidad de la Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica (SEIMC). En el presente artículo se muestra el análisis de resultados del Programa de Control de Calidad SEIMC de carga viral de estos virus y el genotipado del VHC realizado durante el año 2018. MÉTODOS Y RESULTADOS: En el control de VIH-1 se remitieron 5 estándares, de los que uno (plasma humano seronegativo) no contenía el virus, y los otros 4 consistían en plasma de 3 pacientes virémicos distintos en un intervalo de concentraciones entre 2-5 log10 copias/ml. Una parte significativa de los laboratorios participantes obtuvo de uno a varios resultados fuera de los límites aceptables (media ± 0,25 log10 copias/ml), dependiendo del estándar y del método empleado, en promedio el 26% de los centros. La repetibilidad fue buena, y la mayoría de los laboratorios obtuvieron resultados aceptables (D < 0,5 log10 copias/ml). En los controles de VHC y VHB se remitieron 2 estándares con diferente contenido del virus. La mayor parte de los participantes, un 87% en el caso del VHC y un 88% en el del VHB, obtuvo ambos resultados dentro de los límites de la media ± 1,96 DE log10 UI/ml. CONCLUSIONES: Los resultados obtenidos ponen de manifiesto la utilidad de los controles externos para asegurar la calidad de los resultados analíticos. Debido a la variabilidad interlaboratorio, es aconsejable utilizar un mismo método y el mismo laboratorio en el seguimiento de los pacientes

BACKGROUND: Human immunodeficiency virus type 1 (HIV-1) and hepatitis B (HBV) and C virus (HCV) viral load determinations are among the most relevant markers for the follow-up of patients infected with these viruses. External quality control tools are crucial to ensure the accuracy of the results obtained by microbiology laboratories. This article summarised the results obtained from the 2018 SEIMC External Quality Control Programme for HIV-1, HCV, and HBV viral loads and HCV genotyping. METHODS AND RESULTS: In the HIV-1 program, a total of five standards were sent. One standard consisted of seronegative human plasma, while the remaining four contained plasma from three different viremic patients, in the range of 2-5 log10 copies/mL; two of these standards were identical, with the aim of determining repeatability. A significant proportion of the laboratories (28% on average) obtained values outside the accepted range (mean ± 0.25 log10 copies/mL), depending on the standard and on the method used for quantification. Repeatability was good, with most laboratories reporting results within the limits (D < 0.5 log10 copies/mL). The HBV and HCV programme consisted of two standards with different viral load contents. Most of the participants, 87% in the case of HCV and 88% in the HBV, obtained all the results within the accepted range (mean ± 1.96 SD log10 UI/mL). CONCLUSIONS: Data from this analysis reinforce the utility of proficiency programmes to ensure the quality of the results obtained by a particular laboratory. Due to the marked interlaboratory variability, it is advisable to use the same method and the same laboratory for patient follow-up

Performance of the Xpert HBV Viral Load assay versus the Aptima Quant assay for quantifying hepatitis B virus DNA.

Quantification of HBV DNA is used for initiating and monitoring antiviral treatment. We have evaluated the Xpert HBV Viral Load (VL) assay on the GeneXpert instrument. We estimated its limit of detection to be 7.5 IU/mL. Reproducibility was 1.1-12.7% as assessed by the coefficients of variation for 3 different samples. The assay was linear from 2 to 8 log10 IU/mL for HBV genotypes A to F. Its clinical performance was evaluated by testing prospectively 100 HBV DNA-positive samples with the Xpert HBV VL and Aptima Quant HBV assays. The results from the 2 assays were correlated, with a modest bias (-0.10 log10 IU/mL) between them by Bland-Altman analysis. Patient monitoring with 80 samples performed with both assays gave similar patient profiles with trends in the same direction. The Xpert HBV Viral load assay is reliable enough for quantifying HBV DNA in clinical practice.

Evaluation of the results of MOTAKK hepatitis C virus RNA genotyping and hepatitis delta virus external quality assessment programs during 2015-2016.

BACKGROUND/AIMS: To evaluate the HCV RNA genotyping and HDV RNA tests that are performed in molecular microbiology laboratories in Turkey as part of a national external quality assessment programme, MOTAKK (Moleküler Tanida Kalite Kontrol) (English translation: Quality control in molecular diagnostics). MATERIALS AND METHODS: Plasmas having different HCV RNA genotypes were used to prepare HCV genotype control sera. The HDV RNA main stock was prepared from patients with chronic delta hepatitis who had a significant amount of viral load detected, as per the WHO reference materials on viral load studies that were compiled for the purpose of developing HDV RNA control sera. Samples with different viral loads were prepared from this main stock by dilution. The prepared controls were delivered to the registered laboratories. The laboratories carried out the relevant tests and entered their results via the MOTAKK web page. External quality assessment (EQA) reports of the participants were uploaded to the website as well. RESULTS: In total, there were 23 participating laboratories, out of which 20 exclusively performed HCV genotyping, and 15 and 16 only performed HDV RNA in 2015 and 2016, respectively. The success rate of the results of the HCV genotype was 56-96% in 2015 and 30-95% in 2016. The tube with a 30% success rate had a recombinant type of HCV, therefore, it could not be detected in most of the laboratories. The HDV RNA results were evaluated qualitatively. Accordingly, HDV RNA detection rates of participant laboratories were 71-100% in 2015 and 50-100% in 2016. CONCLUSION: This study was the first national external quality control program in Turkey regarding HCV RNA genotyping and HDV RNA in the field of molecular microbiology, and it was implemented successfully.

Accurate dried blood spots collection in the community using non-medically trained personnel could support scaling up routine viral load testing in resource limited settings.

Regular plasma HIV-RNA testing for persons living with HIV on antiretroviral therapy (ART) is now the global standard, but as many as 60% of persons in Africa today on ART do not have access to standard laboratory HIV-RNA assays. As a result, patients in Zambia often receive treatment without any means of determining true virologic failure, which poses a risk of premature switch of ART regimens and widespread HIV drug resistance. Dry blood spots (DBS) on the other hand require unskilled personnel and less complex storage supply chain so are ideal to capture viral-load results from HIV patients outside clinic settings. We assess collection of DBS in the community using non-medically trained personnel (NMP) and documented challenges. We trained 23 NMP to collect DBS from lost to follow-up (LTFU) patients in 4 rural and urban Zambian districts. We developed a phlebotomy box to transport DBS without contamination at ambient temperature and concomitant training and standard operating procedures. We evaluated this through field observations, bi-weekly meetings, reports, and staff meetings. The laboratory assessed DBS quality for testing validity. We attempted to collect DBS from 357 participants in the community. Though individual reasons for refusal from the remaining 37% were not collected, NMPs reported privacy concerns, awkward box-size which drew attention in the community and fears of undisclosed uses of samples related to witchcraft and circulating narratives about past research. Successful DBS collection was not associated with patient gender, age, time on ART, enrolment CD4, facility. DBS viral-load collection by NMP is feasible in Zambia. Our training approach and assessments of NMP not part of the health system can be extended to patients by giving them more responsibility to manage their own differentiated care groups. Concerted efforts that compare collection of DBS by NMP to those collected by skilled-medical personnel are needed.

Impact of Fragmentation on Commutability of Epstein-Barr Virus and Cytomegalovirus Quantitative Standards.

Despite the adaptation of international standards, quantitative viral load testing of transplant-associated viruses continues to be limited by interlaboratory disagreement. Studies have suggested that this disagreement and the poor commutability of standards may, in some cases, be linked to amplicon size and the fragmentation of circulating viral DNA. We evaluated target fragmentation as a cause of noncommutability and pretest fragmentation of quantitative standards as a potential means of increasing commutability and interassay agreement. Forty-two cytomegalovirus (CMV)-positive and 41 Epstein-Barr virus (EBV)-positive plasma samples, together with two different quantitative standards for each virus, were tested as unknowns using 10 different quantitative PCR assays at 5 different laboratories. Standards were tested both intact and after intentional fragmentation by ultrasonication. Quantitative agreement between methods was assessed, together with commutability, using multiple statistical approaches. Most assays yielded results within 0.5 log10 IU/ml of the mean for CMV, while for EBV a greater variability of up to 1.5 log10 IU/ml of the mean was shown. Commutability showed marked improvement following fragmentation of both CMV standards but not after fragmentation of the EBV standards. These findings confirm the impact of amplicon size and target fragmentation on commutability for CMV and suggest that for some (but not all) viruses, interlaboratory harmonization can be improved through the use of fragmented quantitative standards.