Infants with Congenital Adrenal Hyperplasia Exhibit Thalamic Discrepancies in Early Brain Structure.

INTRODUCTION: Patients with classical congenital adrenal hyperplasia (CAH) have prenatal and postnatal hormonal imbalances. To characterize the ontogeny of reported brain and behavior changes in older children with CAH, we aimed to study the brain structure in infants with CAH compared to healthy controls. METHODS: We performed neuroimaging in 16 infants with classical CAH due to 21-hydroxylase deficiency (8 males, gestational age 38.2 ± 1.7 weeks, post-conceptional age [PCA] 42.2 ± 3.0 weeks) and 14 control infants (9 males, gestational age 38.5 ± 1.8 weeks, PCA 42.5 ± 2.4 weeks) utilizing 3-Tesla magnetic resonance imaging. Regional brain volumes were adjusted for PCA and sex, along with an additional adjustment for total brain volume (TBV), for group comparisons by regression analyses (mean, 95% confidence interval [CI]). The degree to which each brain region was differentiated between CAH and control infants was examined by relaimpo analyses, adjusting for all other brain regions, PCA, and sex. RESULTS: Infants with CAH had significantly smaller thalamic volumes (8,606 mm3, 95% CI [8,209, 9,002]) compared to age-matched control infants (9,215 mm3, 95% CI [8,783, 9,647]; ß = -609; p = 0.02) which remained smaller after further adjustment for TBV. Upon further adjustment for TBV, the temporal lobe was larger in infants with CAH (66,817 mm3, CI [65,957, 67,677]) compared to controls (65,616 mm3, CI [64,680, 66,551]; ß = 1,202, p = 0.03). The brain regions most differentiated between CAH versus controls were the thalamus (22%) and parietal lobe (10%). CONCLUSIONS: Infants with CAH exhibit smaller thalamic regions from early life, suggesting a prenatal influence on brain development in CAH. Thalamic emergence at 8-14 weeks makes the region particularly vulnerable to changes in the intrauterine environment, with potential implications for later maturing brain regions. These changes may take time to manifest, meriting longitudinal study through adolescence in CAH.

Moyamoya syndrome in a male pseudohermaphrodite patient with congenital adrenal hyperplasia - a rare association. Case report and review of literature.

BACKGROUND AND IMPORTANCE: Moyamoya syndrome causes progressive stenosis of intracranial internal carotid arteries and may be associated with genetic disorders like Down's or Turner's syndromes. We treated a male pseudohermaphrodite patient with congenital adrenal hyperplasia (CAH) with clinical and radiological features of moyamoya vasculopathy. To our knowledge, this association has not been reported. CLINICAL PRESENTATION: The 42-year-old patient presented with an intraventicular bleed. Cerebral angiography revealed moyamoya vasculopathy. He was hypertensive and had primary amenorrhea. Secondary sexual characteristics were poorly developed and he had ambiguous genitalia. Breast development was Tanner stage 3. Investigation revealed hypokalemia. With primary amenorrhea, persistent hypokalemia, hypertension and ambiguous genitalia, CAH was considered as a possibility and confirmed on hormone profile. Karyotyping revealed 46XY pattern. Abdominal ultrasound revealed hyperplasia of the adrenal glands, absent uterus and ovaries and ectopic testicles in inguinal canals. He was put on steroids and his blood pressure controlled. CONCLUSIONS: To the best of our knowledge we report the first case of moyamoya syndrome occurring in association with CAH.

A Case of Prenatally Diagnosed Congenital Adrenal Hyperplasia With Brain Morphometric Differences.

We report a case of a fetus with a prenatal diagnosis of classical congenital adrenal hyperplasia (CAH) due to 21-hydroxylase deficiency. Although CAH is typically assessed postnatally, this fetal case had multiple prenatal clinical assessments made feasible by an interdisciplinary CAH center. The approach facilitated the development and delivery of comprehensive and earlier care for the fetus, and the family living with this complex, congenital condition, with perinatology, endocrinology, genetic counseling, psychology, and urology involvement. As well, the addition of fetal MRI to standard ultrasound revealed significant deficits in the biparietal diameter, occipitofrontal diameter, and total intracranial volume of the fetal CAH brain. These early anomalies in the brain suggest that neurological comorbidities observed in older children and adults with CAH should be studied as early as prenatally, with the addition of fetal MRI to ultrasound potentially being useful for identifying and understanding prenatal anomalies in CAH.

Changes in resting-state functional connectivity in patients with congenital adrenal hyperplasia.

CONTEXT: Patients with congenital adrenal hyperplasia (CAH) are treated with life-long glucocorticoid (GC) replacement therapy. Negative effects on cognition, brain structure and function during working memory tasks have been identified. To date, no studies on functional connectivity during rest have been performed in patients with CAH. OBJECTIVE: To investigate resting-state functional connectivity in patients with CAH compared with healthy untreated controls and the association between functional connectivity in the precuneus and disease severity, dose of GC and working memory (WM). DESIGN, SETTING AND PARTICIPANTS: Thirty-one patients with CAH (18 females) and 38 healthy controls (24 females), aged 16-33 years, from a single research institute, underwent functional magnetic resonance imaging of the brain during rest. RESULTS: Patients with CAH showed increased functional connectivity in the precuneus compared with controls. Post-hoc tests within the precuneus showed that only patients with simple virilising CAH had stronger connectivity compared to controls. Further, while both patients with salt-wasting and simple virilising CAH performed worse on a WM task compared to controls, functional connectivity in the precuneus was not associated with executive function performance. CONCLUSION: Patients with CAH demonstrated altered functional connectivity during rest in the precuneus. Such a change may reflect a functional reorganisation in response to the CAH disease. The change in functional connectivity may depend on the severity of CAH.

Congenital Adrenal Hyperplasia and Brain Health: A Systematic Review of Structural, Functional, and Diffusion Magnetic Resonance Imaging (MRI) Investigations.

BACKGROUND: Congenital adrenal hyperplasia (CAH) is a group of genetic disorders that affects the adrenal glands and is the most common cause of primary adrenal insufficiency in children. In the past few decades, magnetic resonance imaging (MRI) has been implemented to investigate how the brain may be affected by CAH. A systematic review was conducted to evaluate and synthesize the reported evidence of brain findings related to CAH using structural, functional, and diffusion-weighted MRI. METHODS: We searched bibliographical databases through July 2021 for brain MRI studies in individuals with CAH. RESULTS: Twenty-eight studies were identified, including 13 case reports or series, 10 studies that recruited and studied CAH patients vs unaffected controls, and 5 studies without a matched control group. Eleven studies used structural MRI to identify structural abnormalities or quantify brain volumes, whereas 3 studies implemented functional MRI to investigate brain activity, and 3 reported diffusion MRI findings to assess white matter microstructure. Some commonly reported findings across studies included cortical atrophy and differences in gray matter volumes, as well as white matter hyperintensities, altered white matter microstructure, and distinct patterns of emotion and reward-related brain activity. CONCLUSIONS: These findings suggest differences in brain structure and function in patients with CAH. Limitations of these studies highlight the need for CAH neuroimaging studies to incorporate larger sample sizes and follow best study design and MRI analytic practices, as well as clarify potential neurologic effects seen across the lifespan and in relation to clinical and behavioral CAH phenotypes.

White Matter Microstructural Differences in Youth With Classical Congenital Adrenal Hyperplasia.

CONTEXT: Gray matter morphology in the prefrontal cortex and subcortical regions, including the hippocampus and amygdala, are affected in youth with classical congenital adrenal hyperplasia (CAH). It remains unclear if white matter connecting these aforementioned brain regions is compromised in youth with CAH. OBJECTIVE: To examine brain white matter microstructure in youth with CAH compared to controls. DESIGN: A cross-sectional sample of 23 youths with CAH due to 21-hydroxylase deficiency (12.9 ±â€…3.5 year; 61% female) and 33 healthy controls (13.1 ±â€…2.8 year; 61% female) with 3T multishell diffusion-weighted magnetic resonance brain scans. MAIN OUTCOME MEASURES: Complementary modeling approaches, including diffusion tensor imaging (DTI) and neurite orientation dispersion and density imaging (NODDI), to examine in vivo white matter microstructure in six white matter tracts that innervate the prefrontal and subcortical regions. RESULTS: DTI showed CAH youth had lower fractional anisotropy in both the fornix and stria terminalis and higher mean diffusivity in the fornix compared to controls. NODDI modeling revealed that CAH youth have a significantly higher orientation dispersion index in the stria terminalis compared to controls. White matter microstructural integrity was associated with smaller hippocampal and amygdala volumes in CAH youth. CONCLUSIONS: These patterns of microstructure reflect less restricted water diffusion likely due to less coherency in oriented microstructure. These results suggest that white matter microstructural integrity in the fornix and stria terminalis is compromised and may be an additional related brain phenotype alongside affected hippocampus and amygdala neurocircuitry in individuals with CAH.

Bone Mass in Young Patients with Congenital Adrenal Hyperplasia due to 21-Hydroxylase Deficiency.

BACKGROUND: The effects of hyperandrogenism and steroid treatment on bone mineral density (BMD) in patients with congenital adrenal hyperplasia (CAH) are controversial. OBJECTIVES: The objectives of this study were to characterize BMD and fractures in patients with CAH and to identify whether there is an association between alterations in BMD, nutritional status, and variables related to the disease. METHODS: A cross-sectional descriptive study was conducted to explore clinical, hormonal, dairy consumption, physical activity, and BMD variables in patients with CAH due to 21-hydroxylase deficiency and controls matched by age, gender, skin color, body mass index, and Tanner scale. RESULTS: Fifty subjects (CAH n = 25; females n = 42 [84%]) with a mean age of 15.9 ± 5.8 years were included in the study. White skin color predominated in 34 subjects (68%), mestizo in 11 (22%), and black in 5 (10%). In patients with CAH, BMD lumbar spine was decreased compared to that in controls (0.83 ± 0.23 vs. 0.98 ± 0.26 g/cm3, p = 0.004). BMD femur was also decreased in patients with CAH; however, this was not significant (0.95 ± 0.20 vs. 1.04 ± 0.24 g/cm3, p = 0.17). There was a positive relationship between age at diagnosis, age of initiation of glucocorticoid treatment, and testosterone levels with all measurements of BMD. The daily glucocorticoid dose was negatively related to BMD. No fractures were found. CONCLUSIONS: Patients with CAH had decreased BMD, especially in lumbar spine. Increased androgen exposure seemed to improve, while increased glucocorticoid dose impaired BMD.

Transformation of the female genitalia in congenital adrenal hyperplasia: MRI study.

PURPOSE: In this report, we aim to define the different degrees of structural abnormality affecting the female genitalia in cases of CAH by using the multiplanar capabilities and high soft tissue resolution of MRI. PATIENTS AND METHODS: The study included cases of CAH who were referred to our pediatric surgical facility for genital reconstruction during the period 2016 through 2019. We studied the pelvic MRI anatomy in cases of CAH while referring to clinical and operative findings. To set up a grading scale for the degree of virilization in cases of CAH, we included another two control groups of normal boys and girls representing the two ends of the spectrum. RESULTS: The study included 23 cases of CAH who underwent preoperative pelvic MRI examination. All cases had normal chromosomal analysis (46 XX). Their age ranged from 1 to 156 months at time of MRI examination (mean 42.4; median 25). The level of the lower end of the vagina was identified in midsagittal T2WI and confirmed in sequential axial cuts. Based on the level of the lower end of the vagina in relation to the pubic symphysis, we classified cases of CAH into either low or high types. Moreover, we could observe a correlation between the degree of vaginal descent and structural transformation of erectile tissue between both genders. CONCLUSION: MRI can have an important role in the evaluation of cases of CAH by displaying the severity of internal anomaly which is crucial for proper preoperative counseling. TYPE OF STUDY: Case control study. LEVEL OF EVIDENCE: Level III.

Altered Gray Matter Structure and White Matter Microstructure in Patients with Congenital Adrenal Hyperplasia: Relevance for Working Memory Performance.

Congenital adrenal hyperplasia (CAH) has been associated with brain structure alterations, but systematic studies are lacking. We explore brain morphology in 37 (21 female) CAH patients and 43 (26 female) healthy controls, aged 16-33 years, using structural magnetic resonance imaging to estimate cortical thickness, surface area, volume, subcortical volumes, and white matter (WM) microstructure. We also report data on a small cohort of patients (n = 8) with CAH, who received prenatal dexamethasone (DEX). Patients with CAH had reduced whole brain volume (4.23%) and altered structure of the prefrontal, parietal, and superior occipital cortex. Patients had reduced mean FA, and reduced RD and MD, but not after correcting for brain volume. The observed regions are hubs of the visuospatial working memory and default mode (DMN) networks. Thickness of the left superior parietal and middle frontal gyri was associated with visuospatial working memory performance, and patients with CAH performed worse on this task. Prenatal treatment with DEX affected brain structures in the parietal and occipital cortex, but studies in larger cohorts are needed. In conclusion, our study suggests that CAH is associated with brain structure alterations, especially in the working memory network, which might underlie the cognitive outcome observed in patients.

Prenatal and postnatal imaging techniques in the evaluation of disorders of sex development.

Imaging of the reproductive tract is challenging and requires a general knowledge of congenital variations in anatomy. The anatomy of the developing fetus, whether a male phenotype or female phenotype, is also a dynamic process with many changes occurring during gestation. Families may ask details about the genitalia during prenatal imaging and when variations in what is thought to be normal are present, further investigation is sometimes needed to make sense of what is seen. This overview will describe categories of disorders of sex development (DSD), whether chromosomal or structural or both, and the current state of imaging of these anomalies.

Mifepristone Treatment in Four Cases of Primary Bilateral Macronodular Adrenal Hyperplasia (BMAH).

CONTEXT: Primary bilateral macronodular adrenal hyperplasia (BMAH) is a rare form of adrenal Cushing syndrome conventionally treated with adrenalectomy. Medical treatment is often reserved for patients not eligible for surgery. However, to date there have been few studies about the efficacy of mifepristone for the treatment of BMAH associated with hypercortisolism. OBJECTIVE: To describe a series of patients with hypercortisolism due to BMAH treated with mifepristone from multiple medical practices. DESIGN: We retrospectively assessed four patients treated with mifepristone for hypercortisolism due to BMAH who had either failed unilateral adrenalectomy, declined surgery, or were poor surgical candidates. RESULTS: Mifepristone induced clinical improvement and remission of the signs and symptoms of hypercortisolism in all described patients with BMAH. The median treatment duration at the time of efficacy response assessment was 5 months (range: 3 to 18 months). Improvement in cardiometabolic parameters was observed as early as 2 weeks after treatment was started. All patients achieved improvements in glycemic control and hypertension and had significant weight loss. The most common adverse event observed with mifepristone therapy was fatigue. Increases in TSH level occurred in two patients. CONCLUSION: Mifepristone can be an effective medical alternative to surgery in patients with hypercortisolism due to BMAH.

Testicular adrenal rest tumors in patients with congenital adrenal hyperplasia: 6 years of follow-up.

Background Testicular adrenal rest tumors (TARTs) leading to primary gonadal failure are the main etiology of infertility in congenital adrenal hyperplasia (CAH). We aimed at identifying the evolution of TART and related findings in young CAH patients. Methods Twelve male patients (3-23 years old) with 21-hydroxilase deficiency (11 with classic salt-wasting form) were included. Testicular ultrasonography (US) was performed in two moments, by a single blinded specialist in pediatric diagnostic imaging. Tumor progression was classified according to the Response Evaluation Criteria in Solid Tumors (RECIST). The clinical and laboratory data were retrieved from medical records. Serum 17-OH-progesterone (17OHP) and androstenedione concentrations were evaluated during the whole period of follow-up, from the CAH diagnosis. A logistic regression model with repeated measures was developed for the analysis. Results The prevalence of TART was 41.6% (n = 5) in the initial US evaluation and 66.6% (n = 8) after 6 years of follow-up. Tumor progression was detected in 4 of the 5 patients, and 1 presented with a stable tumor. Three patients presented with new tumors in the second evaluation. Most of the patients (n = 11) were pubertal, including a 7-year-old child with TART who presented with central precocious puberty. At regression analysis, it was observed that an inadequate hormonal control led to a 16 times greater chance of a patient to present with TART (OR = 16.08; confidence interval [CI] 95% = 2.38-108.81; p = 0.004). Conclusions We found a high prevalence of progressive TART in young pubertal subjects. US testicular screening should help in improving therapeutic optimization in CAH patients to reduce future impairment in fertility.

Adrenal morphology and associated comorbidities in congenital adrenal hyperplasia.

OBJECTIVE: Adrenonodular hyperplasia and tumour formation are potential long-term complications of congenital adrenal hyperplasia (CAH) with little known regarding the clinical implications. Our aim was to describe volumetric adrenal morphology and determine the association between radiological findings and comorbidities in adults with classic CAH. DESIGN: This was a cross-sectional study of 88 patients (mean age 29.2 ± 13 years, 47 females) with classic CAH seen in a tertiary referral centre. METHODS: CT imaging, performed at study entry or when reaching adulthood, was used to create 3-dimensional volumetric models. Clinical, genetic and hormonal evaluations were collected and correlated with adrenal morphology and tumour formation. RESULTS: Over one-third of the cohort was obese. 53% had elevated 17-OH-progesterone or androstenedione; and 60% had adrenal hyperplasia. Tumours included 11 myelolipomas, 8 benign adrenocortical adenomas, 1 pheochromocytoma and 50% of men had testicular adrenal rest tissue. CAH patients with adrenal hyperplasia had significantly higher number of comorbidities than those with morphologically normal adrenals (P = 0.03). Variables that positively correlated with adrenal volume included hypogonadal/oligomenorrhoeic status, hypertension, androstenedione, aldosterone, and triglyceride levels, and in women, low HDL and insulin resistance. Elevated aldosterone was observed in a subset of patients with simple virilizing CAH. CONCLUSIONS: Adrenocortical hyperplasia is associated with a number of comorbidities, especially hypogonadism. Aldosterone production associated with adrenal enlargement may play a role in the development of metabolic risk factors. Further studies are needed to assess the long-term impact of the excess adrenal steroid milieu associated with adrenal enlargement to develop improved management strategies for CAH.

Epicardial Fat Thickness in Children with Classic Congenital Adrenal Hyperplasia

Objective: Epicardial fat thickness (EFT) is an emerging cardio-metabolic risk factor and has been shown to be related to atherosclerosis. EFT has not been studied in the context of CAH. This study aimed to evaluate EFT in children with CAH and its relation to carotid artery intima-media thickness (CA-IMT) and left ventricular (LV) functions. Methods: Thirty-six children with classical CAH were compared with 36 healthy controls. All patients had confirmed CAH and were receiving steroid substitution therapy. Patients and controls underwent anthropometric evaluation, measurement of fasting lipids, glucose, insulin, homeostasis model assessment for insulin resistance (HOMA-IR). LV functions and EFT were assessed using conventional echocardiography. Duplex ultrasonography was used to measure CA-IMT. Results: Compared to controls, patients had greater EFT (p=0.001), CA-IMT (p=0.01), LV mass index (LVMI) (p=0.001) and prolonged mitral deceleration time (DcT) (p=0.01). CAH patients also had significantly worse HOMA-IR (p=0.001) than controls. Abnormalities were worse in uncontrolled CAH on treatment. Multivariate analysis in CAH subjects showed EFT correlated positively with waist circumference odds ratio (OR) [OR=1.9; 95% confidence interval (CI): 1.07-1.14; p=0.01], 17-hydroxyprogesterone [OR=1.6; 95% CI: 1.33-2.89; p=0.05], testosterone concentration (OR=1.7; 95% CI: 1.55-2.13; p=0.01), LVMI (OR=1.14; 95% Cl: 1.08-1.13; p=0.01), mitral DcT (OR=2.25; 95% CI: 1.15-2.05; p=0.01) and CA-IMT (OR=1.6; 95% CI: 1.15-2.05; p=0.01). Conclusion: EFT is elevated in children with classical CAH, particularly in those with poor control, and is correlated with CA-IMT, LV mass and mitral DcT. Measurement of EFT in CAH children may help to identify those at high risk of developing LV dysfunction and subclinical atherosclerosis.

Homocysteine Level in Children with Classic Congenital Adrenal Hyperplasia: Relationship to Carotid Intimal Wall Thickness and Left Ventricular Function.

BACKGROUND/AIMS: Homocysteine is an important and independent risk factor for atherosclerotic diseases. The aim of this study was to evaluate serum levels of homocysteine in children with congenital adrenal hyperplasia (CAH) and their relation to carotid artery intima-media thickness (CA-IMT) and left ventricular (LV) function. METHODS: This study included 36 children with classic CAH and 36 healthy children. All underwent anthropometric evaluation. Measurement of serum levels of total homocysteine was carried out. The LV mass (LVM) and function were assessed using conventional echocardiography. Duplex ultrasonography was used to measure CA-IMT. RESULTS: Compared to the controls, the patients had higher homocysteine levels (p = 0.001), a thicker CA-IMT (p = 0.01), a higher LVM index (LVMI) (p = 0.001), and a prolonged mitral deceleration time (DcT) (p = 0.01). Abnormalities were marked in children who were uncontrolled on medical treatment. In multivariate analysis, homocysteine levels were significantly correlated with systolic (OR = 2.2; 95% CI: 1.10-1.18; p = 0.01) and diastolic blood pressures (OR = 2.9; 95% CI: 1.45-2.4; p = 0.01), atherogenic index (OR = 2.6; 95% CI: 1.33-2.89; p = 0.01), HOMA-IR (OR = 1.3; 95% CI: 1.04-1.34; p = 0.001), LVMI (OR = 2.6; 95% CI: 1.1-1.13; p = 0.001), mitral DcT (OR = 2.4; 95% CI: 1.15-2.05; p = 0.01), and CA-IMT (OR = 1.6; 95% CI: 1.16-1.57; p = 0.01). CONCLUSIONS: Serum total homocysteine was elevated in children with classic CAH, particularly in those with poor control on medical treatment, and it was correlated with CA-IMT, LVMI, and mitral DcT. Measurement of homocysteine in children with CAH may help to identify those at high risk of developing LV dysfunction and subclinical atherosclerosis.

A Chinese patient with 11ß-hydroxylase deficiency due to novel compound heterozygous mutation in CYP11B1 gene: a case report.

BACKGROUND: Congenital adrenal hyperplasia (CAH) resulting from steroid 11ß-hydroxylase deficiency (11ß-OHD) is caused by mutations in the CYP11B1 gene. It is the second major form of CAH associated with hypertension and hypopotassemia. The aim of this study was to provide a genetic analysis of 11ß-OHD in a Chinese family. CASE PRESENTATION: A 19-year-old Chinese man was clinically diagnosed with 11ß-OHD. His initial clinical manifestations included precocious puberty, hyperpigmentation, hypertension, and hypopotassemia. The patient had taken an overdose of dexamethasone (0.75 mg/d) for more than 10 years before finally developing iatrogenic Cushing's syndrome. Our aim was to perform a molecular diagnosis of his family. Mutations in the CYP11B1 gene of the patient and his parents were examined using polymerase chain reaction (PCR) resequencing. Additionally, to predict the possible effects of novel mutations on the structure and function of 11ß-hydroxylase, these mutations were analyzed by MutationTaster software. Two novel pathogenic mutations were found in the CYP11B1 gene: a heterozygous in-frame insertion deletion mutation c.1440_1447delinsTAAAAG in exon 9 inherited from the father and a heterozygous mutation c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC (p.364_372del) in exon 6 inherited from the mother. CONCLUSIONS: A clear genetic diagnosis can be made by analyzing the functional and structural consequences of CYP11B1 gene mutations that lead to 11ß-OHD. Because the dosage of glucocorticoid should be adjusted to minimize the risk of iatrogenic Cushing's syndrome, clinical follow-up should be conducted with these patients.