Untargeted metabolomics and DNA barcoding for discrimination of Phyllanthus species.

ETHNOPHARMACOLOGICAL RELEVANCE: Phyllanthus species is extensively cultivated and used as edible fruits and herbal drugs. The Phyllanthus species are used extensively as ethnopharmacologically important materials in several countries, especially in Asia. Various Phyllanthus species are broadly used in the Ayurvedic system of medicine and deliberated as bitter, astringent, stomachic, diuretic, febrifuge, deobstruent, and antiseptic, and used for the treatment of digestive, genitourinary, respiratory, skin diseases, hepatopathy, jaundice, and renal calculus in India. Precise authentification of Phyllanthus species is a challenge due to morphological similarities and is important to avoid adulteration found in herbal drugs. Hence, there is a need to establish comprehensive methods for the identification of Phyllanthus species. AIM OF THE STUDY: In this study, we attempted to integrate untargeted metabolomics to identify species-specific metabolites with traditional phylogenetic analysis for identification and discrimination of nine Phyllanthus species. MATERIALS AND METHODS: Phyllanthus species such as P. acidus, P. amarus, P. debilis, P. emblica, P. virgatus, P. urinaria, P. lawii, P. myrtifolius, and P. reticulatus were collected. The liquid chromatography coupled mass spectrometry (LC-MS) was performed for untargeted metabolite profiling and MS/MS fragmentation analysis was performed for selected compounds. Further, the barcoding analysis was executed using plastid loci, rpoC1 to integrate with metabolite profiling data. RESULTS: The Principal Component Analysis (PCA) of leaf metabolites showed distinct clusters in different species. Through further analysis, we have also identified the qualitative and quantitative status of unique metabolites across the species, and the majority of the selected compounds were annotated. The metabolic fingerprinting and the hierarchical clustering indicated that though the P. deblis and P. virgatus are distantly related to each other, they are closely associated with their metabolic profiling. Similarly, P. myrtifolius and P. urinaria are closely related to each other with their metabolic fingerprints than the genetic alignment. Further, we performed barcoding with rpoC1 across nine Phyllanthus species (P. acidus, P. amarus, P. debilis, P. emblica, P. virgatus, P. urinaria, P. lawii, P. myrtifolius, and P. reticulatus). Sequence similarity search in the GenBank database showed rpoC1 barcode loci from nine Phyllanthus species showed significant identity (>97%) with the sequences of various Phyllanthus species. CONCLUSIONS: The bioactive metabolites and their abundance can be assigned to specific species thereby serving as a biological signature and indicators for potential therapeutic use. This study identified differential expression of 14 secondary metabolites from nine Phyllanthus species. Alkaloid compound zeatin was found specific to P. virgatus and delphinidin-3-O- ß -D-glucoside was not found in P. myrtifolius. Barcoding and phylogenetic analysis showed P. acidus is the most genetically distinct among the groups and the sequence pair between P.emblica-P.reticulatus and P.emblica-P.urinaria showed the least difference.

Modeling the potential distribution of Epiphyllum phyllanthus (L.) Haw. under future climate scenarios in the Caatinga biome.

The climate change projections for the Caatinga biome this century are for an increase in temperature and reduction in rainfall, leading to aridization and plant cover dominated by Cactaceae. The objective of this study was to model the potential distribution of Epiphyllum phyllanthus (L.) Haw., a cactus that is native to the Caatinga biome, considering two possible future climate scenarios, to assess this species' spatio-temporal response to these climate change, and thus to evaluate the need or not for conservation measures. For this purpose, we obtained biogeographic information on the target species from biodiversity databases, choosing nine environmental variables and applying the MaxEnt algorithm. We considered the time intervals 2041-2060 and 2061-2080, centered on 2050 and 2070, respectively, and the greenhouse gas scenarios RCP4.5 and 8.5. For all the scenarios considered, the models generated for 2050 and 2070 projected drastic contraction (greater than 80%) for the areas of potential occurrence of the species in relation to the present potential. The remaining areas were found to be concentrated in the northern portion of the biome, specifically in the northern part of the state of Ceará, which has particular characteristics.

A novel effect of geraniin on OPG/RANKL signaling in osteoblasts

In this study, the effects of geraniin on osteoprotegerin/receptor activator of nuclear factor-κB ligand(OPG/RANKL) in regulating the proliferation of osteoblasts and suppression of osteoclast-like cells (OLC) in OLC-osteoblast co-cultured system in vitro were investigated. Osteoblasts were cultured and identified with alkaline phosphatase (ALP), gomori stain, and mineralized nodule stain. OLCs were isolated from long bones of Sprague-Dawley (SD) rats and identified with tartrate-resistant acid phosphatase(TRAP) stain. Methyl thiazolyl tetrazolium assay was used to examine the proliferation of osteoblasts, and immunocytochemistry and in situ hybridization to analyze the expression OPG/RANKL in osteoblasts co-cultured with osteoclasts under the action of geraniin, respectively. Geraniin could regulate the proliferation of osteoblasts MC3T3-E1, decrease the number of OLC in OLC-osteoblast co-cultured system, and inhibit the bone resorption areas and resorption pits of OLC in vitro experiments. Geraniin could promote the mRNA and protein expression levels of OPG and suppress those of RANKL in osteoblasts. These results indicate that geraniin has a promoting effect on the proliferation of osteoblasts and an inhibitory effect on the osteoclastic bone-resorption through regulating OPG/RANKL signaling pathway in OLC-OB co-cultured system.

Authenticity analyses of Phyllanthus amarus using barcoding coupled with HRM analysis to control its quality for medicinal plant product.

The Phyllanthus genus, a plant used in traditional Thai medicine, has according to several pharmacopeias hepatoprotective properties. Not only is the anatomical morphology of these species relatively similar but they also share the Thai common names Look-Tai-Bai (ลูกใต้ใบ) and Yah-Tai-Bai (หญ้าใต้ใบ), which might cause confusion for laypersons. This study attempted to develop a method for accurate identification of Phyllanthus species, especially Phyllanthus amarus, and to detect contaminants in P. amarus products by using DNA barcoding coupled with high resolution melting (HRM) analysis (bar-HRM). Two plastid loci (rbcL and trnL) were chosen for DNA barcoding to generate a suitable primer for distinguishing Phyllanthus species by HRM analysis. The five species of Phyllanthus were subjected to amplification for testing the specificity and discrimination power of the designed primers derived from rbcL and trnL regions. Sensitivity of the method (DNA barcoding conjugated with HRM) to detect adulterant in P. amarus samples was evaluated. The commercial P. amarus products obtained from a local market were authenticated. The primer pair derived from trnL DNA barcoding (PhylltrnL) had more specificity and power of discrimination for Phyllanthus species than that derived from rbcL DNA barcoding (PhyllrbcL). The result showed that Tm of P. amarus, Phyllanthus urinaria, Phyllanthus debilis, Phyllanthus airy-shawii, and Phyllanthus virgatus was 74.3±0.08, 73.04±0.07, 73.36±0.05, 72.21±0.06, 72.77±0.15°C, respectively. This method proved to be a very sensitive tool that can be used for rapid detection of contamination as low as 1% of other Phyllanthus species in P. amarus admixtures. All commercial products of P. amarus obtained from a local market in Thailand were found to contain pure raw materials of P. amarus without any substitution or contamination. Our results indicated that the use of DNA barcoding coupled with HRM was an efficient molecular tool for correct species identification. This molecular tool provides a noteworthy benefit for quality control of medicinal plants and industry plants for pharmacological prospects.

Discrimination and classification techniques applied on Mallotus and Phyllanthus high performance liquid chromatography fingerprints.

Mallotus and Phyllanthus genera, both containing several species commonly used as traditional medicines around the world, are the subjects of this discrimination and classification study. The objective of this study was to compare different discrimination and classification techniques to distinguish the two genera (Mallotus and Phyllanthus) on the one hand, and the six species (Mallotus apelta, Mallotus paniculatus, Phyllanthus emblica, Phyllanthus reticulatus, Phyllanthus urinaria L. and Phyllanthus amarus), on the other. Fingerprints of 36 samples from the 6 species were developed using reversed-phase high-performance liquid chromatography with ultraviolet detection (RP-HPLC-UV). After fingerprint data pretreatment, first an exploratory data analysis was performed using Principal Component Analysis (PCA), revealing two outlying samples, which were excluded from the calibration set used to develop the discrimination and classification models. Models were built by means of Linear Discriminant Analysis (LDA), Quadratic Discriminant Analysis (QDA), Classification and Regression Trees (CART) and Soft Independent Modeling of Class Analogy (SIMCA). Application of the models on the total data set (outliers included) confirmed a possible labeling issue for the outliers. LDA, QDA and CART, independently of the pretreatment, or SIMCA after "normalization and column centering (N_CC)" or after "Standard Normal Variate transformation and column centering (SNV_CC)" were found best to discriminate the two genera, while LDA after column centering (CC), N_CC or SNV_CC; QDA after SNV_CC; and SIMCA after N_CC or after SNV_CC best distinguished between the 6 species. As classification technique, SIMCA after N_CC or after SNV_CC results in the best overall sensitivity and specificity.

Comparison of two exploratory data analysis methods for classification of Phyllanthus chemical fingerprint: unsupervised vs. supervised pattern recognition technologies.

In this study, unsupervised and supervised classification methods were compared for comprehensive analysis of the fingerprints of 26 Phyllanthus samples from different geographical regions and species. A total of 63 compounds were identified and tentatively assigned structures for the establishment of fingerprints using high-performance liquid chromatography time-of-flight mass spectrometry (HPLC/TOFMS). Unsupervised and supervised pattern recognition technologies including principal component analysis (PCA), nearest neighbors algorithm (NN), partial least squares discriminant analysis (PLS-DA), and artificial neural network (ANN) were employed. Results showed that Phyllanthus could be correctly classified according to their geographical locations and species through ANN and PLS-DA. Important variables for clusters discrimination were also identified by PCA. Although unsupervised and supervised pattern recognitions have their own disadvantage and application scope, they are effective and reliable for studying fingerprints of traditional Chinese medicines (TCM). These two technologies are complementary and can be superimposed. Our study is the first holistic comparison of supervised and unsupervised pattern recognition technologies in the TCM chemical fingerprinting. They showed advantages in sample classification and data mining, respectively.

Avaliação de extratos de quebra- pedra (Phyllanthus sp) frente à patógenos causadores de infecções no trato urinário / Evaluation of Phyllanthus sp extracts in face of Pathogen Causers of Urinary Treat Infections

RESUMO O trato urinário normalmente é estéril, no entanto, pode ser contaminado por agentes etiológicos provenientes da microbiota intestinal, dentre os mais comuns pode-se destacar a Escherichia coli. Os microrganismos estão se tornando cada vez mais resistentes a múltiplos antimicrobianos. É notória, portanto, a necessidade de encontrar novas substâncias com propriedades antimicrobianas. Portanto, foram avaliados diferentes extratos de Phyllanthus sp, frente a microrganismos causadores de infecções no trato urinário e comparadas as técnicas de hole-plate e disco difusão. Para ambas as técnicas avaliadas, o extrato de 72 horas mostrou melhor atividade antimicrobiana, na técnica de disco difusão, a bactéria mais sensível foi o Staphylococcus saprophyticcus, que apresentou CMI (Concentração Mínima Inibitória) de 15,84 mg/mL. Com a utilização da técnica de hole-plate, a bactéria mais sensível observada foi Staphylococcus aureus, com valor de CMI igual ao reportado anteriormente. Foi observado que os extratos alcoólicos obtiveram maior eficiência em relação às infusões, que a técnica de hole-plate revelou ser mais eficiente que a técnica de disco difusão e que os cocos Gram positivos foram mais susceptíveis quando comparadas aos bacilos Gram negativos e fungos.

ABSTRACT Commonly, the urinary treat is sterile, but it can also be contaminated by etiological agents from the intestinal treat, of which the Escherichiacoli is the most common one. These microorganisms are increasingly becoming more resistant to multiple antibiotics. It became necessary to find new substances with antimicrobial properties, so the purpose of this paper is to evaluate different Phyllanthus sp extracts- in face of microorganisms which cause the urinary treat infections- and compare it to the hole-plate and disk diffusion techniques. The 72 hours extraction showed better antimicrobial activity in both methods. Using disk diffusion, the most sensitive bacterium was the Staphylococcus saprophyticcus, with the MIC of 15,84 mg/mL. While using the technique of hole-plate, the most sensitive bacterium was the Staphylococcus aureus, with the same MIC of the previous cited bacterium. This study showed that the alcoholic extracts were more efficient than the infusions. It can also be observed that the hole-plate technique seems to be more efficient than the disk diffusion one, and the Gram positive cocci bacteria were more sensitive than the Gram negative bacilli and fungi.

An overview of important ethnomedicinal herbs of Phyllanthus species: present status and future prospects.

The genus Phyllanthus consists of more than 1000 species, of which many are used as traditional medicines. The plant extracts have been used since ancient times, for treating hypertension, diabetes, hepatic, urinary, and sexual disorders, and other common ailments. Modern day scientific investigations have now confirmed pharmacognostic properties of Phyllanthus herbs. The phytochemicals attributing these medicinal properties have been identified in many of the Phyllanthus herbs. The morphologically similar herbs of Phyllanthus grow together and admixture of species during collection for manufacture of herbal medicines is quite common. Hence, along with pharmacognostic and phytochemical studies, appropriate protocols for correct identification of species are also important. As the use of these herbs as green medicines is becoming more popular, it is imperative to assess its genetic diversity and phylogenetic relatedness for future conservation strategies. This review is an attempt to present an overview of the existing studies on pharmacognostics, phytochemistry, species identification, and genetic diversity of Phyllanthus herbs and consequently (i) highlight areas where further research is needed and (ii) draw attention towards extending similar studies in underutilized but potentially important herbs such as P. maderaspatensis, P. kozhikodianus, P. rheedii, P. scabrifolius, and P. rotundifolius.

Characterization of four Phyllanthus species using liquid chromatography coupled to tandem mass spectrometry.

This paper reports a comparison of four Phyllanthus species (P. amarus, P. stipulatus, P. niruri and P. tenellus), commonly known as stone breaker, by the characterization of the chemical profile of their aqueous extracts. Such characterization was carried out using liquid chromatography coupled to ion trap tandem mass spectrometry (LC-IT-MS(n)) under reversed-phase gradient elution mode. The results of MS/MS and MS(3) on-line experiments, using the electrospray ionization source in the positive and negative mode, are extensively discussed. Furthermore, quercetin-3-O-ß-d-glucuronopyranoside was isolated in multimilligram scale from the aqueous extract of P. stipulatus and characterized by mass spectrometry and NMR. Although it is an unusual flavonol in natural products, LC-IT-MS(n) experiments showed it to be present also in P. amarus.

Identification of species-diagnostic inter simple sequence repeat markers for ten Phyllanthus species.

Phyllanthus has been widely used in traditional medicine as an antipyretic, a diuretic, and to treat liver diseases and viral infections. Correct genotype identification of medicinal plant material remains important for the botanical drug industry. Limitations of chemical and morphological approaches for authentication have generated the need for newer methods in quality control of botanicals. In the present study, attempts were made to identify species-diagnostic markers for ten Phyllanthus species using the inter simple sequence repeat-polymerase chain reaction (ISSR-PCR) fingerprinting method. PCR amplification using seven ISSR primers resulted in significant polymorphism among the populations from different species. P. angustifolius and P. urinaria showed monomorphic frequency of maximum (63.88%) and minimum (20.64%), respectively. Seventeen species-diagnostic markers were identified for seven species (P. acidus, P. emblica, P. fraternus, P. urinaria, P. rotundifolius, P. amarus, and P. angustifolius) while no marker was detected for P. reticulatus, P. nivosus, and P. virgulatus. A maximum of six species-diagnostic markers were identified for P. acidus and a minimum of only one of 755 bp was available for P. amarus. Among the seventeen markers, nine were present in all individuals of particular species. The species-specific differences in fragment numbers and sizes could be used as diagnostic markers to distinguish the Phyllanthus species quickly.

Chromatographic profiles of Phyllanthus aqueous extracts samples: a proposition of classification using chemometric models.

Taking in consideration the global analysis of complex samples, proposed by the metabolomic approach, the chromatographic fingerprint encompasses an attractive chemical characterization of herbal medicines. Thus, it can be used as a tool in quality control analysis of phytomedicines. The generated multivariate data are better evaluated by chemometric analyses, and they can be modeled by classification methods. "Stone breaker" is a popular Brazilian plant of Phyllanthus genus, used worldwide to treat renal calculus, hepatitis, and many other diseases. In this study, gradient elution at reversed-phase conditions with detection at ultraviolet region were used to obtain chemical profiles (fingerprints) of botanically identified samples of six Phyllanthus species. The obtained chromatograms, at 275 nm, were organized in data matrices, and the time shifts of peaks were adjusted using the Correlation Optimized Warping algorithm. Principal Component Analyses were performed to evaluate similarities among cultivated and uncultivated samples and the discrimination among the species and, after that, the samples were used to compose three classification models using Soft Independent Modeling of Class analogy, K-Nearest Neighbor, and Partial Least Squares for Discriminant Analysis. The ability of classification models were discussed after their successful application for authenticity evaluation of 25 commercial samples of "stone breaker."

Molecular phylogenetic analysis of Phyllanthus species in Thailand and the application of polymerase chain reaction-restriction fragment length polymorphism for Phyllanthus amarus identification.

The genus Phyllanthus (Phyllanthaceae) is distributed in tropical and subtropical regions, and its members are widely used as medicinal plants in many countries. We analyzed the nucleotide sequences of the internal transcribed spacers of ribosomal DNA of 56 plant samples covering 23 Phyllanthus species collected from various habitats in Thailand. Based on the sequence alignment, we constructed phylogenetic trees of all Phyllanthus species distributed in Thailand. Furthermore, a simple protocol to discriminate three important medicinal Phyllanthus species, P. amarus, P. debilis, and P. urinaria, was developed using a Polymerase Chain Reaction-Restriction Fragment Length Polymorphism method and successfully applied to the crude drug samples obtained in Thai markets.

Assessing species admixtures in raw drug trade of Phyllanthus, a hepato-protective plant using molecular tools.

ETHNOPHARMACOLOGICAL RELEVANCE: Phyllanthus (Euphorbiaceae) species are well known for their hepato-protective activity and are used in several ethno-medicines in indigenous health care systems in India. AIM OF THE STUDY: To assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools. MATERIALS AND METHODS: Samples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morpho-taxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward (psbAF - GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR - CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0. RESULTS: Morphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH. CONCLUSION: Our results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw drug trade of Phyllanthus.

Therapeutic potential of Phyllanthus emblica (amla): the ayurvedic wonder.

Medicinal plants are nature's gift to human beings to promote a disease free healthy life. Many medicinal plants are present in a group of herbal preparations of the Indian traditional health care system (Ayurveda) named Rasayana proposed for their interesting antioxidant activities. Phyllanthus emblica Linn. (syn. Emblica officinalis), commonly known as Indian gooseberry or amla, family Euphorbiaceae, is an important herbal drug used in unani (Graceo - arab) and ayurvedic systems of medicine. The plant is used both as a medicine and as a tonic to build up lost vitality and vigor. Phyllanthus emblica is highly nutritious and could be an important dietary source of vitamin C, amino acids, and minerals. The plant also contains phenolic compounds, tannins, phyllembelic acid, phyllembelin, rutin, curcum-inoids, and emblicol. All parts of the plant are used for medicinal purposes, especially the fruit, which has been used in Ayurveda as a potent rasayana and in traditional medicine for the treatment of diarrhea, jaundice, and inflammation. Various plant parts show antidiabetic, hypolipidemic, antibacterial, antioxidant, antiulcerogenic, hepatoprotective, gastroprotective, and chemopreventive properties. Here we discuss its historical, etymological, morphological and pharmacological aspects.

Protocols for in vitro culture and phytochemical analysis of Phyllanthus species (euphorbiaceae).

We developed reproducible protocols for micropropagation, callus culture, and root culture of the medicinal plant Phyllanthus urinaria, P. niruri, P. tenellus, P. corcovadensis, P. caroliniensis, P. stipulatus, and P. fraternus by using single node explants. Genotype-linked differences are visible among the Phyllanthus species concerning shoot culture, callus culture, and root culture growth. The protocols developed for phytochemical screening of callus and root extracts of P. urinaria, P. caroliniensis, P. stipulatus, and P. fraternus have shown the production of sterols and triterpenes. Both compounds are known to account for the antinociceptive activity of the methanolic extracts as glochidone and stigmasterol have strong activity against neurogenic and inflammatory pain. Similarly, methanolic callus extracts of P. tenellus, P. niruri and P. corcovadensis have potent analgesic properties, however phenolics are major compounds isolated from these species. The optimized micropropagation, callus culture, and root culture protocols offer the possibility to use cell/root culture techniques for vegetative propagation and secondary metabolite studies.

SCAR markers for correct identification of Phyllanthus amarus, P. fraternus, P. debilis and P. urinaria used in scientific investigations and dry leaf bulk herb trade.

The trade in Phyllanthus material as bulk herb is rampant and mainly involves herbaceous species such as Phyllanthus amarus, P. fraternus, P . debilis and P. urinaria. These species are very important in herbal medicines and have varied activities. In India these species grow sympatrically and there are chances of deliberate or ignorant adulteration of crude drugs, lowering the efficiency of the medication for its intended purpose. Secondly, incorrect identification may also lead to erroneous reports on activities/molecules. To overcome this problem in crude drug (dry leaf powder) and compliment morphological identification in live plant, we have developed SCAR markers for all four species. In each species, we selected one fragment as being monomorphic between accessions but differing in size between species. These species-specific fragments were selected, cloned and sequenced. Based on the sequences, primer pairs were designed and amplification conditions standardized. SCAR markers were isolated from population DNA amplification profiles and validated by sequencing. The species-specific SCAR primers could retrieve the same size and sequence of fragments as in the RAPD profile. These fragments are 1150 bp, 317 bp, 980 bp and 550 bp in size for P. amarus, P. fraternus, P. debilis and P. urinaria, respectively. Additional fragments in P. debilis and P. urinaria indicate different alleles. The retrieval of same size and sequence of species-specific unique SCAR markers from the respective accessions (mixed DNA sample of same accessions) indicates the usefulness to study natural hybridization between the species in addition to adulteration.

[Study on HPLC fingerprints of Phyllanthus urinaria].

OBJECTIVE: To establish the HPLC fingerprints of Phyllanthus urinaria L. METHODS: The HPLC was used to establish the fingerprint of Phyllanthus urinaria. RESULTS: The HPLC fingerprint profiles of Phyllanthus urinaria contains 10 common peaks. The relative retention time and the relative area of the common peaks were deterimined. CONCLUSION: The fingerprint profile can be used for the identification and quality control of Phyllanthus urinaria.

Development and application of RAPD-SCAR marker for identification of Phyllanthus emblica LINN.

Correct genotype identification of medicinal plant material remains important for botanical drug industry. Limitations of chemical and morphological approaches for authentication have generated need for newer methods in quality control of botanicals. The present study was carried out to develop DNA based marker for identification of Phyllanthus emblica LINN. A putative marker (1.1 kb) specific for P. emblica was identified by Random Amplified Polymorphic DNA (RAPD) technique. Sequence Characterized Amplified Region (SCAR) marker was developed from the RAPD amplicon. The SCAR marker was found useful for identification of P. emblica in its commercial samples and Triphalachurna, a multi-component Ayurvedic formulation.