USP7 inhibitors suppress tumour neoangiogenesis and promote synergy with immune checkpoint inhibitors by downregulating fibroblast VEGF.

BACKGROUND: Understanding how to modulate the microenvironment of tumors that are resistant to immune checkpoint inhibitors represents a major challenge in oncology.Here we investigate the ability of USP7 inhibitors to reprogram the tumor microenvironment (TME) by inhibiting secretion of vascular endothelial growth factor (VEGF) from fibroblasts. METHODS: To understand the role played by USP7 in the TME, we systematically evaluated the effects of potent, selective USP7 inhibitors on co-cultures comprising components of the TME, using human primary cells. We also evaluated the effects of USP7 inhibition on tumor growth inhibition in syngeneic models when dosed in combination with immune checkpoint inhibitors (ICIs). RESULTS: Abrogation of VEGF secretion from fibroblasts in response to USP7 inhibition resulted in inhibition of tumor neoangiogenesis and increased tumor recruitment of CD8-positive T-lymphocytes, leading to significantly improved sensitivity to immune checkpoint inhibitors. In syngeneic models, treatment with USP7 inhibitors led to striking tumor responses resulting in significantly improved survival. CONCLUSIONS: USP7-mediated reprograming of the TME is not linked to its previously characterized role in modulating MDM2 but does require p53 and UHRF1 in addition to the well-characterized VEGF transcription factor, HIF-1α. This represents a function of USP7 that is unique to fibroblasts, and which is not observed in cancer cells or other components of the TME. Given the potential for USP7 inhibitors to transform "immune desert" tumors into "immune responsive" tumors, this paves the way for a novel therapeutic strategy combining USP7 inhibitors with immune checkpoint inhibitors (ICIs).

Assessing the double-edged of extracellular signal-regulated kinase/CCAAT-enhancer-binding protein beta signaling pathway in arsenic-induced skin damage and its potential foodborne interventions.

Arsenic exposure is a major environmental public health challenge worldwide. As typical manifestations for arsenic exposure, the pathogenesis of arsenic-induced skin lesions has not been fully elucidated, as well as the lack of effective control measures. In this study, we first determined the short-term and high-dose arsenic exposure can increase the apoptosis rates, while long-term low-dose arsenic exposure decrease the apoptosis rates. Then, the HaCaT cells with knockdown and overexpression of CCAAT-enhancer-binding protein ß (CEBPB) and extracellular signal-regulated kinase (ERK) were constructed. The results demonstrate that knockdown of CEBPB and ERK can reduce NaAsO2 -induced cell apoptosis by inhibiting ERK/CEBPB signaling pathway and vice versa. Further cells were treated with Kaji-Ichigoside F1 (KF1). The results clearly show that KF1 can decrease the arsenic-induced cell apoptosis rates and the expression of ERK/CEBPB signaling pathway-related genes. These results provide evidence that ERK/CEBPB signaling pathway acts as a double-edged sword in arsenic-induced skin damage. Another interesting finding was that KF1 can alleviate arsenic-induced skin cell apoptosis by inhibiting the ERK/CEBPB signaling pathway. This study will contribute to a deeper understanding of the mechanisms of arsenic-induced skin cell apoptosis, and our findings will help to identify a potential food-borne intervention in arsenic detoxification.

Molecular Mechanisms Responsible for In Vitro Cytotoxic Attributes of Conyza bonariensis Extract against Lymphoblastic Leukaemia Jurkat Cells.

BACKGROUND: Conyza bonariensis is known to have anti-cancer properties. OBJECTIVE: The current study investigated the in vitro pro-apoptotic properties of Conyza bonariensis (C. bonariensis) towards human lymphoblastic leukemia Jurkat cells. METHODS: Ariel parts of C. bonariensis were macerated in a non-polar (n-Hexane) solvent. MTS cell viability assay was employed to determine the cytotoxic activity of the extract towards human leukemia Jurket cells and normal Peripheral Blood Mononuclear Cells (PBMCs). The phytochemical composition of the extract was screened using HPLC method. Flow cytometric studies (FACS) were conducted to explore the pro-apoptotic potential of the extract. Western blot studies were employed to identify the molecular targets involved in the induction of apoptosis. RESULTS: The n-hexane extract showed selective cytotoxic activity towards Jurkat cells. FACS analysis indicated that the extract induced early and late apoptosis in Jurkat cells. Western blot studies revealed that the extract downregulated the expression of DNMT1, SIRT1, and UHRF1 with a simultaneous up-regulation of p73 and caspases-3 proteins expression. HPLC characterization of the extract revealed the presence of phenolic compounds. CONCLUSION: Overall, these findings demonstrate that the anti-cancer effects of a Conyza bonariensis extract towards human lymphoblastic leukemia Jurkat cells are due to the modulation of the activity of multiple oncogenic and tumor suppressor proteins. Phenolic contents of the extract are proposed to be responsible for these activities.

Mechanistic Study of Macranthoside B Effects on Apoptotic Cell Death in Human Cervical Adenocarcinoma Cells.

Macranthoside B (MB) is a triterpenoid saponin extracted from Lonicera macranthoides, a traditional Chinese medicine. In the current study, we investigated the anticancer potential of MB in various cancer cells and elucidated its underlying mechanisms. MB exposure inhibited cell proliferation, induced mitochondrial membrane potential (MMP) loss, increased sub-G1 accumulation, and resulted in cleavage of caspase-3 and PARP, which are reflective of apoptosis. In HeLa cells, MB induced down-regulation of SOD2 and GPx1, phosphorylation of Akt and PDK1, and thus promoted ROS-mediated apoptosis. This was further supported by the protection of sub-G1 accumulation, MMP loss, cleavage of caspase-3 and PARP in the presence of N-acetylcysteine (NAC). Additionally, MB induced cell death via down-regulation of ubiquitin-like with PHD and ringfinger domains 1 (UHRF1) and Bcl-xL. Taken together, this study provides a new insight into the apoptosis- inducing potential of MB, and its molecular mechanisms are associated with an increase in oxidative stress and inhibition of the PDK1/Akt pathway.

The anti-lipidemic drug simvastatin modifies epigenetic biomarkers in the amphipod Gammarus locusta.

The adverse effects of certain environmental chemicals have been recently associated with the modulation of the epigenome. Although changes in the epigenetic signature have yet to be integrated into hazard and risk assessment, they are interesting candidates to link environmental exposures and altered phenotypes, since these changes may be passed across multiple non-exposed generations. Here, we addressed the effects of simvastatin (SIM), one of the most prescribed pharmaceuticals in the world, on epigenetic regulation using the amphipod Gammarus locusta as a proxy, to support its integration into hazard and environmental risk assessment. SIM is a known modulator of the epigenome in mammalian cell lines and has been reported to impact G. locusta ecological endpoints at environmentally relevant levels. G. locusta juveniles were exposed to three SIM environmentally relevant concentrations (0.32, 1.6 and 8 µg L-1) for 15 days. Gene transcription levels of selected epigenetic regulators, i.e., dnmt1, dmap1, usp7, kat5 and uhrf1 were assessed, along with the quantification of DNA methylation levels and evaluation of key ecological endpoints: survival and growth. Exposure to 0.32 and 8 µg L-1 SIM induced significant downregulation of DNA methyltransferase 1 (dnmt1), concomitant with global DNA hypomethylation and growth impacts. Overall, this work is the first to validate the basal expression of key epigenetic regulators in a keystone marine crustacean, supporting the integration of epigenetic biomarkers into hazard assessment frameworks.

Bacterial lipopolysaccharide induces type 2 deiodinase in cultured rat astrocytes.

In the brain, 3,5,3'-triiodothyronine, which binds to the thyroid hormone receptor with high affinity, is locally generated from thyroxine by type 2 iodothyronine deiodinase (D2) expressed mainly in astrocytes and tanycytes. We have investigated the effects of bacterial lipopolysaccharide (LPS) on D2 in cultured rat astrocytes. LPS induced D2 activity with a lag-time of 4-8 h and a maximum at 24 h. LPS also promoted D2 mRNA accumulation. Glucocorticoids enhanced both the basal and LPS-stimulated D2 activity and mRNA accumulation. These glucocorticoid effects were blocked by the glucocorticoid receptor antagonist RU486. Our results obtained with different specific signaling pathway inhibitors indicated that D2 induction by LPS required ERK and p38-MAPK signaling pathways. NF-κB inhibitor sulfasalazine blocked the effects of LPS on both D2 activity and mRNA accumulation. Hence, D2 induction by LPS appeared to implicate NF-κB pathway in astrocytes. NF-κB responsiveness of the rat dio2 gene was studied in astrocytes with dio2 5'-flanking region promoter assays. The long form of the dio2 promoter was transactivated by NF-κB. CCAAT/enhancer-binding protein ß, which is upregulated by LPS in astrocytes, increased the transcriptional activity of the dio2 promoter in its long or truncated forms containing CCAATs. Our observations, which demonstrate D2 induction by LPS in astrocytes and specify some characteristics of D2 induction mechanism, support the possible implication of brain D2 in adaptative responses to an infectious stress.

Selective deletion of adipocytes, but not preadipocytes, by TNF-alpha through C/EBP- and PPARgamma-mediated suppression of NF-kappaB.

Tumor necrosis factor-alpha (TNF-alpha) is a key regulator of adipose tissue mass, but mechanisms underlying this effect have not been fully elucidated. We found that exposure to TNF-alpha caused a significant decrease in the number of adipocytes, but not preadipocytes. Subsequent experiments revealed that TNF-alpha selectively deleted adipocytes through induction of apoptosis. Following exposure to TNF-alpha, rapid activation of nuclear factor-kappaB (NF-kappaB) was observed only in preadipocytes, but not in adipocytes. Inhibition of NF-kappaB rendered preadipocytes susceptible to TNF-alpha-induced apoptosis, suggesting that different activity of NF-kappaB is the determinant for the distinct apoptotic responses. During adipocyte differentiation, expression and activity of peroxisome proliferator-activated receptor-gamma (PPARgamma) were upregulated. Treatment of preadipocytes with a PPARgamma agonist attenuated NF-kappaB activation and rendered the cells vulnerable to TNF-alpha-induced apoptosis. Conversely, treatment of adipocytes with a PPARgamma antagonist enhanced NF-kappaB activation and conferred resistance to TNF-alpha-induced apoptosis, suggesting involvement of PPARgamma in the suppression of NF-kappaB in adipocytes. We also found that, following differentiation, expression and activity of CCAAT/enhancer binding protein (C/EBP), especially C/EBPalpha and C/EBPbeta, were upregulated in adipocytes. Overexpression of individual C/EBPs significantly inhibited activation of NF-kappaB in preadipocytes. Furthermore, transfection with siRNA for C/EBPalpha or C/EBPbeta enhanced activity of NF-kappaB in adipocytes, suggesting that C/EBP is also involved in the repression of NF-kappaB in adipocytes. These results suggested novel mechanisms by which TNF-alpha selectively deletes adipocytes in the adipose tissue. The C/EBP- and PPARgamma-mediated suppression of NF-kappaB may contribute to TNF-alpha-related loss of adipose tissue mass under certain pathological situations, such as cachexia.

CCAAT/enhancer binding protein homologous protein-dependent death receptor 5 induction and ubiquitin/proteasome-mediated cellular FLICE-inhibitory protein down-regulation contribute to enhancement of tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis by dimethyl-celecoxib in human non small-cell lung cancer cells.

2,5-Dimethyl-celecoxib (DMC) is a derivative of celecoxib, a cyclooxygenase-2 (COX-2) inhibitor with anticancer activity in both preclinical studies and clinical practice, and lacks COX-2-inhibitory activity. Several preclinical studies have demonstrated that DMC has better apoptosis-inducing activity than celecoxib, albeit with undefined mechanisms, and exhibits anticancer activity in animal models. In this study, we primarily investigated DMC's cooperative effect with tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) on the induction of apoptosis and the underlying mechanisms in human non-small-cell lung cancer (NSCLC) cells. We found that DMC was more potent than celecoxib in decreasing the survival and inducing apoptosis of NSCLC cells. When combined with TRAIL, DMC exerted enhanced or synergistic effects on the induction of apoptosis, indicating that DMC cooperates with TRAIL to augment the induction of apoptosis. To determine the underlying mechanism of the synergy between DMC and TRAIL, we have demonstrated that DMC induces a CCAAT/enhancer binding protein homologous protein-dependent expression of DR5, a major TRAIL receptor, and reduces the levels of cellular FLICE-inhibitory protein (c-FLIP) (both the long and short forms), key inhibitors of death receptor-mediated apoptosis, by facilitating c-FLIP degradation through a ubiquitin/proteasome-dependent mechanism. It is noteworthy that enforced expression of c-FLIP or silencing of DR5 expression using DR5 small interfering RNA abrogated the enhanced effects on induction of apoptosis by the combination of DMC and TRAIL, indicating that both DR5 up-regulation and c-FLIP reduction contribute to cooperative induction of apoptosis by the combination of DMC and TRAIL. Together, we conclude that DMC sensitizes human NSCLC cells to TRAIL-induced apoptosis via induction of DR5 and down-regulation of c-FLIP.

Norepinephrine stimulates calprotectin expression in human monocytic cells.

BACKGROUND AND OBJECTIVE: Calprotectin is composed of two proteins, S100A8 and S100A9, which are S100 family members, and is detected in gingival crevicular fluid and gingival tissue with inflammation. The release and production of calprotectin are regulated by lipopolysaccharides of periodontopathic bacteria and cytokines. Emotional or psychological stress, a risk factor of periodontal disease, is transmitted by stress modulators including norepinephrine and cortisol. The aim of the present study was to investigate the effect of stress on calprotectin expression using norepinephrine and cortisol. METHODS: U-937 cells, a human monocytic cell line, were incubated with norepinephrine in the presence or absence of beta- or alpha-adrenergic receptor antagonists, or with cortisol. The expression of S100A8/S100A9 mRNAs was examined by northern blotting and the amount of calprotectin was measured by enzyme-linked immunosorbent assay (ELISA). The DNA binding activity of C/EBPalpha (CCAAT enhancing binding protein), a transcription factor, was examined by electrophoretic mobility shift assay. RESULTS: Norepinephrine stimulated the expression of S100A8/S100A9 mRNAs via beta-adrenergic receptors in U-937 cells and significantly increased calprotectin production to about 3.6-fold that of the control. However, cortisol had no effect on calprotectin expression at the mRNA and protein levels. Norepinephrine elevated C/EBPalpha DNA binding activity, but cortisol did not increase the activity. CONCLUSION: Norepinephrine, a stress modulator, stimulated calprotectin expression in human monocytic cells. Calprotectin expression may be regulated by stress in addition to inflammatory factors.

The role of AMP-activated protein kinase in the action of ethanol in the liver.

BACKGROUND & AIMS: Our previous work has shown that ethanol induces the fatty acid synthesis pathway by activation of sterol regulatory element-binding protein 1 (SREBP-1). In the present study, we studied the mechanisms of this activation by identifying a new target of ethanol, AMP-activated protein kinase (AMPK). METHODS: The effects of ethanol on AMPK, acetyl-CoA carboxylase (ACC), and SREBP-1 were assessed in rat hepatic cells and in the livers of ethanol-fed mice. RESULTS: In rat hepatoma H4IIEC3 or McA-RH 7777 cell lines, ethanol-induced transcription of an SREBP-regulated promoter was suppressed by the presence of 5-aminoimidazole-4-carboxamide ribonucleoside (AICAR) or metformin, 2 known AMPK activators. Consistent with this, over expression of a constitutively active form of AMPK blocked the effect of ethanol, whereas coexpression of a dominant-negative form of AMPK augmented the effect. Moreover, activation of AMPK by metformin or AICAR largely blocked the ability of ethanol to increase levels of mature SREBP-1 protein. These findings suggest that the effect of ethanol on SREBP-regulated promoter activation was partially mediated through AMPK inhibition. We further demonstrated that AMPK was inhibited by ethanol in hepatic cells. In parallel, ethanol increased the activity of ACC and suppressed the rate of palmitic acid oxidation. Finally, feeding mice a low-fat diet with ethanol resulted in significantly reduced hepatic AMPK activity, increased ACC activity, and enhanced malonyl CoA content. CONCLUSIONS: Taken together, our findings suggest that AMPK may play a key role in regulating the effects of ethanol on SREBP-1 activation, fatty acid metabolism, and development of alcoholic fatty liver.

Differential effects on human immunodeficiency virus type 1 replication by alpha-defensins with comparable bactericidal activities.

In addition to their antibacterial activities, certain antimicrobial peptides inactivate enveloped viruses, including the human immunodeficiency virus (HIV). To determine whether peptide bactericidal activities are predictive of antiviral activity, the anti-HIV properties of recombinant human alpha-defensin 5, mouse alpha-defensins, cryptdins (Crp) 3 and 4, and rhesus macaque myeloid alpha-defensins (RMADs) 3 and 4 were determined in vitro. The peptides, purified to homogeneity, had equivalent bactericidal activities that were similar to those of the native molecules. Nuclear magnetic resonance spectroscopy showed RMAD-4 and Crp3 had characteristic alpha-defensin tridisulfide arrays. Of the peptides analyzed, only RMAD-4 inhibited HIV infectivity at 150 microg/ml, and Crp3 unexpectedly increased HIV replication. Quantitative real-time PCRs for minus-strand strong stop DNA and complete viral cDNA synthesis were used to distinguish between preentry and postentry anti-HIV effects by RMAD-4. Viral exposure to RMAD-4 for 1 h prior to infection reduced HIV minus-strand strong stop DNA and HIV cDNA by 4- to 20-fold during the first round of replication, showing that RMAD-4-exposed virions were not entering cells during the first 24 h. On the other hand, when RMAD-4 was added coincident with HIV inoculation, no anti-HIV activity was detected. Viral exposure to Crp3 resulted in a threefold increase in both HIV minus-strand strong stop DNA and HIV cDNA over the first round of replication. Therefore, two alpha-defensins, RMAD-4 and Crp3, inhibit or augment HIV replication, respectively, by mechanisms that precede reverse transcription.

Soy isoflavones affect sterol regulatory element binding proteins (SREBPs) and SREBP-regulated genes in HepG2 cells.

Soy intake reduces cholesterol levels. However, both the identity of the soy component or components that contribute to this reduction and the cellular mechanism producing this reduction are unknown. Soy consists of protein, lipids, fiber, and phytochemicals including isoflavones. We propose that the isoflavone component of soy mediates this effect, at least in part, by affecting cellular sterol homeostasis. We investigated the effects of an isoflavone-containing soy extract and the individual isoflavones on the maturation of the sterol regulatory element binding proteins (SREBP) and the expression of SRE-regulated genes controlling lipid metabolism. We found a corresponding increase in the mature form of SREBP-2 in both soy extract- and isoflavone-treated HepG2 cells, whereas there was no significant change in the levels of SREBP-1. 3-Hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase protein and HMG CoA synthase mRNA levels also increased. When HepG2 cells were transiently transfected with HMG CoA synthase and LDL receptor reporter plasmids there was an increase in expression in response to soy extract or isoflavone treatment from both of these promoters, but this induction was blunted in the presence of sterols (P < 0.05). The mechanism responsible for this effect may be via a statin-like inhibition of HMG CoA reductase enzyme activity or by enhanced SREBP processing via the SREBP cleavage activating protein. We hypothesize that maturation of SREBP and induction of SRE-regulated genes produce an increase in surface LDL receptor expression that increases the clearance of plasma cholesterol, thus decreasing plasma cholesterol levels.

Metal-responsive transcription factor-1 (MTF-1) selects different types of metal response elements at low vs. high zinc concentration.

Metal-responsive transcription factor-1 (MTF-1) is a zinc finger protein with a central role in heavy metal homeostasis/detoxification. MTF-1 binds to DNA sequence motifs known as metal response elements (MREs) with a core consensus TGCRCNC. Since MTF-1 is also involved in other stress responses, we tested whether it is able to recognize different types of DNA sequence motifs. To this end we selected MTF-1-binding oligonucleotides from a collection of random sequences. Since MTF-1 binds to known target sequences at relatively high zinc concentrations, oligonucleotide selection was performed in a mammalian cell nuclear extract both at high and low zinc concentrations. Irrespective of zinc concentration, we find a robust representation of MRE consensus sequences, however with specific features. Selection was most efficient at 100 microM zinc, yielding many oligonucleotides with two MRE motifs in divergent orientation of the sequence GTGTGCATCACTTTGCGCAC (core consensus underlined). Oligonucleotides selected without zinc supplement contain a single high-affinity MRE with an extended flanking sequence of consensus TTTTGCGCACGGCACTAAAT (core consensus underlined). This low-zinc MRE motif can bind MTF-1 and induce transcription in vivo, and is less dependent on zinc than the classical MREd motif from the mouse metallothionein-I promoter. At low zinc, we also found evidence for a negative role of nuclear factor-I (NF-I/CTF-I) in MTF-1-dependent transcription. Finally, a selection in the presence of cadmium yielded no specific binding site for MTF-1, strongly supporting the concept of an indirect activation of MTF-1 by cadmium within a living cell.

Functional mapping of tissue-specific elements of the human alpha-fetoprotein gene enhancer.

Serum alpha-fetoprotein (AFP) levels in hepatocellular carcinoma (HCC) patients and expression of the protein in cultured HCC cell lines are highly variable. These observations may arise from features correlated with tissue-specific expression of the gene. Extremely strong and potent liver-specific enhancer activity is confined from -4.1 to -3.3 kb upstream to the human AFP gene in contrast with that of the rodent which exists in three widely separated regions. To understand the tissue-specific expression of AFP, we examined cis-acting elements in the enhancer. Results revealed binding sites for selected liver-enriched transcription factors (LETFs) in both domains A (-4120 to -3756 bp) and B (-3492 to -3300 bp) of the gene. These sites included: one hepatocyte nuclear factor (HNF)-1 and HNF-4, two HNF-3, and two C/EBP binding sites in domain A. An adjacent domain B contained one HNF-3 site and three C/EBP sites plus a previously identified HNF-1 site. Each of these elements alone has the ability to stimulate heterogeneous promoter activity in a dose-dependent manner when transfected into AFP producing cells. A comparative study showed that the presence of two HNF-1 and one HNF-4 site is a characteristic feature of human but not rodent AFP enhancer. The mRNA levels of the liver-enriched transcription factors (LETFs) were variable in individual HCC cell lines and together with silencer activities may underlie differential expression of the AFP gene.

Sox21 is a repressor of neuronal differentiation and is antagonized by YB-1.

Sox21, a high-mobility group box transcription factor, is expressed throughout the immature neural stem/progenitor population in ventricular zone but not in the cortical plate in embryonic mouse brain and its expression is restricted to the subventricular zone in the adult brain. In undifferentiated PC12 cells, endogenous Sox21 expression is detected but its expression ceases during the nerve growth factor (NGF)-induced neuronal differentiation. Overexpression of Sox21 results in a substantial repression of NGF-induced neurite outgrowth in PC12 cells. Further, we biochemically identified a Sox21-associating protein, Y-box binding protein 1 which not only binds to Sox21 but also partially restores NGF-induced neurite outgrowth of PC12 cells inhibited by Sox21. These results suggest that Sox21 is a repressor of neuronal differentiation in the developing nervous system.

CCAAT/enhancer binding protein homologous protein (DDIT3) induces osteoblastic cell differentiation.

CCAAT/enhancer binding protein (C/EBP) homologous protein (CHOP/DDIT3), a member of the C/EBP family of transcription factors, plays a role in cell survival and differentiation. CHOP/DDIT3 binds to C/EBPs to form heterodimers that do not bind to consensus Cebp sequences, acting as a dominant-negative inhibitor. CHOP/DDIT3 blocks adipogenesis, and we postulated it could induce osteoblastogenesis. We investigated the effects of constitutive CHOP/DDIT3 overexpression in murine ST-2 stromal cells transduced with retroviral vectors. ST-2 cells differentiated toward osteoblasts, and CHOP/DDIT3 accelerated and enhanced the appearance of mineralized nodules, and the expression of osteocalcin and alkaline phosphatase mRNAs, particularly in the presence of bone morphogenetic protein-2. CHOP/DDIT3 overexpression opposed adipogenesis, and did not cause substantial changes in cell number. CHOP/DDIT3 overexpression did not modify C/EBPalpha or -beta mRNA levels but decreased C/EBPdelta after 24 d of culture. Electrophoretic mobility shift and supershift assays demonstrated that overexpression of CHOP/DDIT3 decreased the binding of C/EBPs to their consensus sequence by interacting with C/EBPalpha and -beta, confirming its dominant-negative role. In addition, CHOP/DDIT3 enhanced bone morphogenetic protein-2/Smad signaling. In conclusion, CHOP/DDIT3 enhances osteoblastic differentiation of stromal cells, in part by interacting with C/EBPalpha and -beta and also by enhancing Smad signaling.

Transcriptional regulation of the human transferrin gene by GADD153 in hepatoma cells.

The transcription factor CHOP/GADD153 is reportedly induced by cellular stresses such as UV light, genotoxic agents, and protein misfolding in the endoplasmic reticulum. However, the mechanism whereby induction of the GADD153 gene is linked to a downstream pathway is still unclear. Previously, we observed that a synthetic retinoid N-(4-hydroxyphenyl)retinamide (4HPR) effectively impaired cell growth and survival (induction of growth arrest and apoptosis) in human hepatoma cells, which was accompanied by over expression of GADD153. Furthermore, GADD153-transfected Hep 3B cells were growth arrested and were sensitized to drug-induced apoptosis. Thus, in this study, we used suppression subtractive hybridization (SSH) to identify GADD153 target genes that were up-regulated or down-regulated in the GADD153 transfectants. We screened 614 sequence-verified clones by Northern blotting, of which 42 genes were scored as over expressed and 17 genes as under expressed in GADD153 transfectants compared with control vector transfectants. Of those genes, 49 corresponded to known genes in public databases. Among them, we further verified that the expression of transferrin (Tf), which is a negative acute-phase protein and is essential to cell survival as a growth factor, was highly modulated by drug-induced GADD153 over expression or by in vitro transfection. GADD153 significantly antagonized the C/EBP (C/EBP-alpha, -beta, and -delta)-mediated transcriptional activation of the Tf gene. In conclusion, Tf and other target genes identified may play a functional role in the downstream pathway of GADD153.

Acetyl-CoA carboxylase beta gene is regulated by sterol regulatory element-binding protein-1 in liver.

Acetyl-CoA carboxylase (ACC) exists as two major isoforms originated from separate genes: ACCalpha (or ACC1) and ACCbeta (or ACC2). Previous data revealed that ACCbeta has two forms of mRNA with different 5'-untranslated regions derived by different usage of promoters, I and II, in human. In this study, we revealed that ACCbeta expression in liver is markedly stimulated by food intake at the transcriptional level. In the process of this induction in rat liver, promoter II plays the major role in regulating the expression of ACCbeta gene. The transient transfection with promoter II-luciferase reporters elucidated that the region from -93 to -38 nucleotides is important for the responsiveness to sterol regulatory element-binding protein-1 (SREBP-1), which is known to be the principle mediator for the stimulation of gene transcriptions by insulin and diet. The Sp1-binding site (-71 to -66) and neighboring two conserved SREs (-62 to -44) play a critical role in the stimulation of ACCbeta gene expression by SREBP-1. In vivo chromatin immunoprecipitation assay revealed that SREBP-1 directly bound to ACCbeta promoter II in liver, and its binding was regulated by the diet. This study provides evidence that ACCbeta expression in liver is regulated at the transcriptional level by the direct interaction of SREBP-1 with promoter II.

Diindolylmethane alters gene expression in human keratinocytes in vitro.

Indole-3-carbinol (I3C) and its dimer 3,3'-diindolylmethane (DIM), obtained from dietary consumption of cruciferous vegetables, have multiple biochemical activities. Both compounds have been effective clinically in treating precancerous lesions of the cervix and laryngeal papillomas, pathologies with a human papillomavirus (HPV) component. Using cDNA microarrays, we examined early changes in gene expression after treatment with 100 micro mol/L DIM in C33A and CaSki cervical cancer cells and in an immortalized human epithelial cell line (HaCat), as well as in normal human foreskin keratinocytes (HFK). Multiple analyses were done after treating C33A cells for 6 h; other analyses included 4- and 12-h treatments of C33A and 6-h treatments of CaSki, HaCat and HFK cells. DIM consistently altered the expression of >100 genes at least twofold. Many of the stimulated genes encode transcription factors and proteins involved in signaling, stress response and growth. Results were comparable between transformed cells with and without integrated HPV sequences, and many of the same genes were induced in these cancer-derived cells and in noncancer cells. Eight genes encoding bZip proteins were among the most consistently and robustly induced, including the stress-associated immediate early gene GADD153 (>50 fold in C33A) and nuclear factor-interleukin 6 (NF-IL6), also known as c/EBPbeta, (>5 fold in C33A), which has been shown to reduce expression of HPV oncogenes. Induction of GADD153, NF-IL6 and ATF3 was confirmed by Western analysis. In functional analyses, DIM not only suppressed transcription of a luciferase gene driven by the HPV11 upstream regulatory region (URR) in C33A, CaSki, HaCat and HFK cells from >2-fold to 37-fold depending on the type of cells, but also reduced endogenous transcription of HPV16 oncogenes to undetectable levels in CaSki cells as determined by an RNase protection assay. Ectopic expression of GADD153 or NF-IL6 suppressed transcription in a dose-dependent manner driven by the HPV11 URR in C33A, CaSki, HaCat and HFK cells. These results identify unexpected ways in which dietary I3C and DIM invoke cellular responses and are consistent with a potential antiviral effect of DIM on keratinocytes, but they do not explain the differential sensitivity of transformed keratinocytes to apoptosis by DIM.

Sterol regulatory element binding protein-1c expression and action in rat muscles: insulin-like effects on the control of glycolytic and lipogenic enzymes and UCP3 gene expression.

Sterol regulatory element binding protein-1c (SREBP-1c) is a transcription factor that mediates insulin effects on hepatic gene expression. It is itself transcriptionally stimulated by insulin in hepatocytes. Here we show that SREBP-1c mRNA is expressed in adult rat skeletal muscles and that this expression is decreased by diabetes. The regulation of SREBP-1c expression was then assessed in cultures of adult muscle satellite cells. These cells form spontaneously contracting multinucleated myotubes within 7 days of culture. SREBP-1c mRNA is expressed in contracting myotubes. A 4-h treatment with 100 nmol/l insulin increases SREBP-1c expression and nuclear abundance by two- to threefold in myotubes. In cultured myotubes, insulin increases the expression of glycolytic and lipogenic enzyme genes and inhibits the 9-cis retinoic acid-induced UCP3 expression. These effects of insulin are mimicked by adenovirus-mediated expression of a transcriptionally active form of SREBP-1c. We conclude that in skeletal muscles, SREBP-1c expression is sensitive to insulin and can transduce the positive and negative actions of the hormone on specific genes and thus has a pivotal role in long-term muscle insulin sensitivity.