Virology. A virus that infects a hyperthermophile encapsidates A-form DNA.

Extremophiles, microorganisms thriving in extreme environmental conditions, must have proteins and nucleic acids that are stable at extremes of temperature and pH. The nonenveloped, rod-shaped virus SIRV2 (Sulfolobus islandicus rod-shaped virus 2) infects the hyperthermophilic acidophile Sulfolobus islandicus, which lives at 80°C and pH 3. We have used cryo-electron microscopy to generate a three-dimensional reconstruction of the SIRV2 virion at ~4 angstrom resolution, which revealed a previously unknown form of virion organization. Although almost half of the capsid protein is unstructured in solution, this unstructured region folds in the virion into a single extended α helix that wraps around the DNA. The DNA is entirely in the A-form, which suggests a common mechanism with bacterial spores for protecting DNA in the most adverse environments.

First insights into the entry process of hyperthermophilic archaeal viruses.

A decisive step in a virus infection cycle is the recognition of a specific receptor present on the host cell surface, subsequently leading to the delivery of the viral genome into the cell interior. Until now, the early stages of infection have not been thoroughly investigated for any virus infecting hyperthermophilic archaea. Here, we present the first study focusing on the primary interactions between the archaeal rod-shaped virus Sulfolobus islandicus rod-shaped virus 2 (SIRV2) (family Rudiviridae) and its hyperthermoacidophilic host, S. islandicus. We show that SIRV2 adsorption is very rapid, with the majority of virions being irreversibly bound to the host cell within 1 min. We utilized transmission electron microscopy and whole-cell electron cryotomography to demonstrate that SIRV2 virions specifically recognize the tips of pilus-like filaments, which are highly abundant on the host cell surface. Following the initial binding, the viral particles are found attached to the sides of the filaments, suggesting a movement along these appendages toward the cell surface. Finally, we also show that SIRV2 establishes superinfection exclusion, a phenomenon not previously described for archaeal viruses.

Maximizing the potential of electron cryomicroscopy data collected using direct detectors.

Single-particle electron cryomicroscopy is undergoing a technical revolution due to the recent developments of direct detectors. These new recording devices detect electrons directly (i.e. without conversion into light) and feature significantly improved detective quantum efficiencies and readout rates as compared to photographic films or CCDs. We evaluated here the potential of one such detector (Gatan K2 Summit) to enable the achievement of near-atomic resolution reconstructions of biological specimens when coupled to a widely used, mid-range transmission electron microscope (FEI TF20 Twin). Compensating for beam-induced motion and stage drift provided a 4.4Å resolution map of Sulfolobus turreted icosahedral virus (STIV), which we used as a test particle in this study. Several motion correction and dose fractionation procedures were explored and we describe their influence on the resolution of the final reconstruction. We also compared the quality of this data to that collected with a FEI Titan Krios microscope equipped with a Falcon I direct detector, which provides a benchmark for data collected using a high-end electron microscope.

Simple and elegant design of a virion egress structure in Archaea.

Some viruses of Archaea use an unusual egress mechanism that involves the formation of virus-associated pyramids (VAPs) on the host cell surface. At the end of the infection cycle, these structures open outward and create apertures through which mature virions escape from the cell. Here we describe in detail the structure and composition of VAPs formed by the Sulfolobus islandicus rod-shaped virus 2 (SIRV2) in cells of its hyperthermophilic archaeal host. We show that the VAPs are stable and autonomous assemblies that can be isolated from membranes of infected cells and purified without affecting their structure. The purified VAPs are heterogeneous in size, reflecting the dynamics of VAP development in a population of infected cells; however, they have a uniform geometry, consisting of seven isosceles triangular faces forming a baseless pyramid. Biochemical and immunoelectron microscopy analyses revealed that the 10-kDa P98 protein encoded by the SIRV2 virus is the sole component of the VAPs. The VAPs were produced in Sulfolobus acidocaldarius and Escherichia coli by heterologous expression of the SIRV2-P98 gene. The results confirm that P98 is the only constituent of the VAPs and demonstrate that no other viral protein is involved in the assembly of pyramids. P98 was able to produce stable structures under conditions ranging from moderate to extremely high temperatures (80 °C) and from neutral to extremely acidic pH (pH 2), demonstrating another remarkable property of this exceptional viral protein.

The architecture and chemical stability of the archaeal Sulfolobus turreted icosahedral virus.

Viruses utilize a diverse array of mechanisms to deliver their genomes into hosts. While great strides have been made in understanding the genome delivery of eukaryotic and prokaryotic viruses, little is known about archaeal virus genome delivery and the associated particle changes. The Sulfolobus turreted icosahedral virus (STIV) is a double-stranded DNA (dsDNA) archaeal virus that contains a host-derived membrane sandwiched between the genome and the proteinaceous capsid shell. Using cryo-electron microscopy (cryo-EM) and different biochemical treatments, we identified three viral morphologies that may correspond to biochemical disassembly states of STIV. One of these morphologies was subtly different from the previously published 27-A-resolution electron density that was interpreted with the crystal structure of the major capsid protein (MCP). However, these particles could be analyzed at 12.5-A resolution by cryo-EM. Comparing these two structures, we identified the location of multiple proteins forming the large turret-like appendages at the icosahedral vertices, observed heterogeneous glycosylation of the capsid shell, and identified mobile MCP C-terminal arms responsible for tethering and releasing the underlying viral membrane to and from the capsid shell. Collectively, our studies allow us to propose a fusogenic mechanism of genome delivery by STIV, in which the dismantled capsid shell allows for the fusion of the viral and host membranes and the internalization of the viral genome.

Stygiolobus rod-shaped virus and the interplay of crenarchaeal rudiviruses with the CRISPR antiviral system.

A newly characterized archaeal rudivirus Stygiolobus rod-shaped virus (SRV), which infects a hyperthermophilic Stygiolobus species, was isolated from a hot spring in the Azores, Portugal. Its virions are rod-shaped, 702 (+/- 50) by 22 (+/- 3) nm in size, and nonenveloped and carry three tail fibers at each terminus. The linear double-stranded DNA genome contains 28,096 bp and an inverted terminal repeat of 1,030 bp. The SRV shows morphological and genomic similarities to the other characterized rudiviruses Sulfolobus rod-shaped virus 1 (SIRV1), SIRV2, and Acidianus rod-shaped virus 1, isolated from hot acidic springs of Iceland and Italy. The single major rudiviral structural protein is shown to generate long tubular structures in vitro of similar dimensions to those of the virion, and we estimate that the virion constitutes a single, superhelical, double-stranded DNA embedded into such a protein structure. Three additional minor conserved structural proteins are also identified. Ubiquitous rudiviral proteins with assigned functions include glycosyl transferases and a S-adenosylmethionine-dependent methyltransferase, as well as a Holliday junction resolvase, a transcriptionally coupled helicase and nuclease implicated in DNA replication. Analysis of matches between known crenarchaeal chromosomal CRISPR spacer sequences, implicated in a viral defense system, and rudiviral genomes revealed that about 10% of the 3,042 unique acidothermophile spacers yield significant matches to rudiviral genomes, with a bias to highly conserved protein genes, consistent with the widespread presence of rudiviruses in hot acidophilic environments. We propose that the 12-bp indels which are commonly found in conserved rudiviral protein genes may be generated as a reaction to the presence of the host CRISPR defense system.

A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus.

Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 +/- 50 nm long and 22 +/- 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.

Bacteriophage observations and evolution.

Bacteriophages are classified into one order and 13 families. Over 5100 phages have been examined in the electron microscope since 1959. At least 4950 phages (96%) are tailed. They constitute the order Caudovirales and three families. Siphoviridae or phages with long, noncontractile tails predominate (61% of tailed phages). Polyhedral, filamentous, and pleomorphic phages comprise less than 4% of bacterial viruses. Bacteriophages occur in over 140 bacterial or archaeal genera. Their distribution reflects their origin and bacterial phylogeny. Bacteriophages are polyphyletic, arose repeatedly in different hosts, and constitute 11 lines of descent. Tailed phages appear as monophyletic and as the oldest known virus group.

Remarkable morphological diversity of viruses and virus-like particles in hot terrestrial environments.

Electron microscopic studies of the viruses in two hot springs (85 degrees C, pH 1.5-2.0, and 75-93 degrees C, pH 6.5) in Yellowstone National Park revealed particles with twelve different morphotypes. This diversity encompassed known viruses of hyperthermophilic archaea, filamentous Lipothrixviridae, rod-shaped Rudiviridae, and spindle-shaped Fuselloviridae, and novel morphotypes previously not observed in nature. Two virus types resembled head-and-tail bacteriophages from the families Siphoviridae and Podoviridae, and constituted the first observation of these viruses in a hydrothermal environment. Viral hosts in the acidic spring were members of the hyperthermophilic archaeal genus Acidianus.