Role of the Serine/Threonine Kinase 11 (STK11) or Liver Kinase B1 (LKB1) Gene in Peutz-Jeghers Syndrome.

Peutz-Jeghers syndrome (PJS) is a well-described inherited syndrome, characterized by the development of gastrointestinal polyps and characteristic mucocutaneous freckling. PJS is an autosomal prevailing disease, due to genetic mutation on chromosome 19p, manifested by restricted mucocutaneous melanosis in association with gastrointestinal (GI) polyposis. The gene for PJS has recently been shown to be a serine/threonine kinase, known as LKB1 or STK11, which maps to chromosome subband 19p13.3. This gene has a putative coding region of 1302 bp, divided into nine exons, and acts as a tumor suppressor in the hamartomatous polyps of PJS patients and in the other neoplasms that develop in PJS patients. It is probable that these neoplasms develop from hamartomas, but it remains possible that the LKB1 or STK11 locus plays a role in a different genetic pathway of tumor growth in the cancers of PJS patients. This article focuses on the role of LKB1 or STK11 gene expression in PJS and related cancers.

Effects of Peutz-Jeghers syndrome (PJS) causing missense mutations L67P, L182P, G242V and R297S on the structural dynamics of LKB1 (Liver kinase B1) protein.

The liver kinase B1 (LKB1) is encoded by LKB1 gene. Several pathogenic mutations of LKB1 causing Peutz-Jeghers syndrome and also cancers in breast, gastric, pancreas, and colon have been reported. The present study is focused to analyze the effects on the structural dynamics of LKB1 caused by the 4 pathogenic missense mutations (L67P, L182P, G242V, and R297S), which are reported to reduce the catalytic activity. In this study, the structural changes of LKB1 in apo- and in heterotrimeric complex (LKB1-STRADα-MO25α) form with wild and mutated LKB1 are investigated using all atomistic molecular dynamic simulation. The present study reveals that these four mutations initiate local structural distortions and the solvent accessibility of the surrounding regions of ATP-binding pocket such as glycine-rich loop, αB and αC loop, activation and catalytic loops. The mutations of L67P, L182P, and G242 V induce distortions of the secondary structure of ß1-ß3 sheets, π - π interaction (observed between Phe204 of LKB1 and Phe243 of MO25α), and increase the helical properties (both helical twist and length) of the adjacent αH-helix, respectively. The active kinase features like the conformation of catalytic and activation loops, salt bridge and, finally, the formation of stable R- and C-hydrophobic spines are also found to be perturbed by these mutations. Hence, the observed mutation-induced structural distortions fail to coordinate the essential binding nature of LKB1 with STRADα and MO25α, which eventually affects the native function of LKB1. These observations are in line with the experimentally reported reduced kinase activity of LKB1.

A 23-Nucleotide Deletion in STK11 Gene Causes Peutz-Jeghers Syndrome and Malignancy in a Chinese Patient Without a Positive Family History.

BACKGROUND AND AIMS: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND RESULTS: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. CONCLUSIONS: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.

Genetic Screening and Analysis of LKB1 Gene in Chinese Patients with Peutz-Jeghers Syndrome.

BACKGROUND Peutz-Jeghers syndrome (PJS) is an autosomal dominant genetic disease. It severely decreases patient quality of life and leads elevated cancer risk. Germline mutation of LKB1 is the leading cause of familial PJS. MATERIAL AND METHODS To characterize the germline mutation of LKB1 gene in Chinese familial and sporadic PJS patients, 14 PJS families, 5 sporadic PJS patients, and 250 healthy adults were collected and genomic DNAs of peripheral blood were extracted. Mutation screenings of LKB1 were performed using MLPA (multiplex ligation-dependent probe amplification), PCR, direct sequencing, and PCR-DHPLC (denaturing high-performance liquid chromatography). RESULTS A total of 12 kinds of germline mutations were found in 9 familial PJS patients, most of which were point mutations (7/12); 4 large deletions of LKB1 were also observed. Of the 12 mutations, 7 were pathogenic (2 were de novo), 4 were just polymorphisms, and 1 was indefinitely pathogenic. No pathogenic mutation in exons of the LKB1 gene was detected in the 5 sporadic PJS patients. The mutation detection rate for the LKB1 gene was 85.7% in our Chinese familial PJS and 63.2% in all Chinese PJS patients. Eight familial PJS patients were identified with pathogenic germline mutations in 14 unrelated families (57.1%). Further methylation detection and analysis showed promoter methylation in carcinomatous polyps. CONCLUSIONS LKB1 gene germline mutation with pathogenic effect is a common cause of familial PJS in Chinese patients; however, it is not the only molecular pathogen of PJS. Methylation in the LKB1 gene promoter region may cause carcinomatous change in intestinal polyps.

Clinical features, endoscopic polypectomy and STK11 gene mutation in a nine-month-old Peutz-Jeghers syndrome Chinese infant.

AIM: To investigate multiple polyps in a Chinese Peutz-Jeghers syndrome (PJS) infant. METHODS: A nine-month-old PJS infant was admitted to our hospital for recurrent prolapsed rectal polyps for one month. The clinical characteristics, a colonoscopic image, the pathological characteristics of the polyps and X-ray images of the intestinal perforation were obtained. Serine threonine-protein kinase 11 (STK11) gene analysis was also performed using a DNA sample from this infant. RESULTS: Here we describe the youngest known Chinese infant with PJS. Five polyps, including a giant polyp of approximately 4 cm × 2 cm in size, were removed from the infant's intestine. Laparotomy was performed to repair a perforation caused by pneumoperitoneum. The pathological results showed that this child had PJS. Molecular analysis of the STK11 gene further revealed a novel frameshift mutation (c.64_65het_delAT) in exon 1 in this PJS infant. CONCLUSION: The appropriate treatment method for multiple polyps in an infant must be carefully considered. Our results also show that the STK11 gene mutation is the primary cause of PJS.

Energy sensing and cancer: LKB1 function and lessons learnt from Peutz-Jeghers syndrome.

We describe in this review increasing evidence that loss of LKB1 kinase in Peutz-Jeghers syndrome (PJS) derails the existing natural balance between cell survival and tumour growth suppression. LKB1 deletion can plunge cells into an energy/oxidative stress-induced crisis which leads to the activation of alternative and often carcinogenic pathways to maintain cellular energy levels. It therefore appears that although LKB1 deficiency can suppress oncogenic transformation in the short term, it can ultimately lead to more progressed and malignant phenotypes by driving abnormal cell differentiation, genomic instability and increased tumour heterogeneity.

[Pilot clinical and genetic study of Russian patients with Peutz-Jeghers syndrome].

Peutz-Jeghers syndrome is a rare hereditary syndrome characterized by presence of hamartoma polyps in intestinal tract and usually by mucocutaneous pigmentation. Clinical-genetic characteristics of Russian patients with Peutz-Jeghers syndrome were studied for the first time. Four germline mutations in STK11gene were found in probands from six families and three of them had not been described previously. Clinical pattern of disease in Russian patients included: frequent polyposis of colon and stomach (62,5% and 75%, respectively) along with small bowel; frequent presence of malignant tumors (62,5%). These clinical aspects can help physicians to find out Peutz-Jeghers syndrome. Molecular-genetic testing of individuals should be recommended.

Exome Sequencing Reveals Germline SMAD9 Mutation That Reduces Phosphatase and Tensin Homolog Expression and Is Associated With Hamartomatous Polyposis and Gastrointestinal Ganglioneuromas.

Hamartomatous polyposis syndromes (HPS) account for a small but appreciable proportion of inherited gastrointestinal cancer predisposition syndromes; patients with HPS have an increased risk for colon and extracolonic malignancies. We present a unique case of familial juvenile polyposis syndrome associated with gastrointestinal ganglioneuromas of unknown etiology. The patient was tested for HPS-associated genes, but no mutation was detected. Exome sequencing identified a germline heterozygous mutation in SMAD9 (SMAD9(V90M)). This mutation was predicted to be an activating mutation. HEK cells transfected to express SMAD9(V90M) had reduced expression of phosphatase and tensin homolog; this reduction was also observed in a polyp from the patient. We have therefore identified a new susceptibility locus for HPS. Patients with hamartomatous polyposis in the colon associated with ganglioneuromatosis should be referred for genetic assessments.

Recent progress on liver kinase B1 (LKB1): expression, regulation, downstream signaling and cancer suppressive function.

Liver kinase B1 (LKB1), known as a serine/threonine kinase, has been identified as a critical cancer suppressor in many cancer cells. It is a master upstream kinase of 13 AMP-activated protein kinase (AMPK)-related protein kinases, and possesses versatile biological functions. LKB1 gene is mutated in many cancers, and its protein can form different protein complexes with different cellular localizations in various cell types. The expression of LKB1 can be regulated through epigenetic modification, transcriptional regulation and post-translational modification. LKB1 dowcnstream pathways mainly include AMPK, microtubule affinity regulating kinase (MARK), salt-inducible kinase (SIK), sucrose non-fermenting protein-related kinase (SNRK) and brain selective kinase (BRSK) signalings, etc. This review, therefore, mainly discusses recent studies about the expression, regulation, downstream signaling and cancer suppressive function of LKB1, which can be helpful for better understanding of this molecular and its significance in cancers.

[Mutation analysis of STK11 gene in a Chinese family with Peutz-Jeghers syndrome].

OBJECTIVE: To investigate STK11 gene mutation in a pedigree with Peutz-Jeghers syndrome (PJS). METHODS: A pedigree of PJS was investigated. DNA was extracted from peripheral blood samples from affected and unaffected members of the pedigree and 100 unrelated healthy controls. PCR was performed to amplify all of the 9 coding exons of STK11 gene. PCR products were directly sequenced to detect mutation. RESULTS: A missense mutation p.F354L (c.1062C>G) in exon 8 of the STK11 gene has been identified in all patients with PJS, but was not found in normal individuals from the pedigree and 100 unrelated controls. CONCLUSION: A missense mutation p.F354L of STK11 gene probably underlies the disease in this pedigree.

Hyperamylasemia and pancreatitis following spiral enteroscopy.

BACKGROUND: Acute pancreatitis is a significant potential complication with double-balloon enteroscopy. Hyperamylasemia is frequently observed after both double-balloon enteroscopy and single-balloon enteroscopy but often without associated pancreatitis. Whether the same phenomenon occurs with spiral enteroscopy is currently unknown. AIMS: To determine the incidence of pancreatitis and hyperamylasemia following spiral enteroscopy. METHODS: A prospective cohort study of consecutive patients undergoing proximal spiral enteroscopy was conducted. Serum amylase levels were measured immediately before and following the procedure, combined with observation for clinical signs of pancreatitis. RESULTS: A total of 32 patients underwent proximal spiral enteroscopy, with a mean total procedure time of 51 min (range 30 min to 100 min) and mean depth of insertion of 240 cm (range 50 cm to 350 cm). The diagnostic yield was 50%, with 31% of all procedures being therapeutic. While no patients exhibited signs that raised suspicion of pancreatitis, hyperamylasemia was common (20%). Hyperamylasemia was not significantly associated with procedure duration or depth of insertion but was linked to patients with Peutz-Jeghers syndrome and with the use of propofol sedation, suggesting that it may be more common in difficult cases. CONCLUSIONS: Postprocedural hyperamylasemia occurred frequently with proximal spiral enteroscopy, while no associated pancreatitis was observed. This finding suggests that hyperamylasemia may not necessarily reflect pancreatic injury nor portend a risk for pancreatitis.

The tumor suppressor kinase LKB1: lessons from mouse models.

Mutations in the tumor suppressor gene LKB1 are important in hereditary Peutz-Jeghers syndrome, as well as in sporadic cancers including lung and cervical cancer. LKB1 is a kinase-activating kinase, and a number of LKB1-dependent phosphorylation cascades regulate fundamental cellular and organismal processes in at least metabolism, polarity, cytoskeleton organization, and proliferation. Conditional targeting approaches are beginning to demonstrate the relevance and specificity of these signaling pathways in development and homeostasis of multiple organs. More than one of the pathways also appear to contribute to tumor growth following Lkb1 deficiencies based on a number of mouse tumor models. Lkb1-dependent activation of AMPK and subsequent inactivation of mammalian target of rapamycin signaling are implicated in several of the models, and other less well characterized pathways are also involved. Conditional targeting studies of Lkb1 also point an important role of LKB1 in epithelial-mesenchymal interactions, significantly expanding knowledge on the relevance of LKB1 in human disease.

mTOR and HIF-1alpha-mediated tumor metabolism in an LKB1 mouse model of Peutz-Jeghers syndrome.

Peutz-Jeghers syndrome (PJS) is a familial cancer disorder due to inherited loss of function mutations in the LKB1/ STK11 serine/threonine kinase. PJS patients develop gastrointestinal hamartomas with 100% penetrance often in the second decade of life, and demonstrate an increased predisposition toward the development of a number of additional malignancies. Among mitogenic signaling pathways, the mammalian-target of rapamycin complex 1 (mTORC1) pathway is hyperactivated in tissues and tumors derived from LKB1-deficient mice. Consistent with a central role for mTORC1 in these tumors, rapamycin as a single agent results in a dramatic suppression of preexisting GI polyps in LKB1+/- mice. However, the key targets of mTORC1 in LKB1-deficient tumors remain unknown. We demonstrate here that these polyps, and LKB1- and AMPK-deficient mouse embryonic fibroblasts, show dramatic up-regulation of the HIF-1alpha transcription factor and its downstream transcriptional targets in an rapamycin-suppressible manner. The HIF-1alpha targets hexokinase II and Glut1 are up-regulated in these polyps, and using FDG-PET, we demonstrate that LKB1+/- mice show increased glucose utilization in focal regions of their GI tract corresponding to these gastrointestinal hamartomas. Importantly, we demonstrate that polyps from human Peutz-Jeghers patients similarly exhibit up-regulated mTORC1 signaling, HIF-1alpha, and GLUT1 levels. Furthermore, like HIF-1alpha and its target genes, the FDG-PET signal in the GI tract of these mice is abolished by rapamycin treatment. These findings suggest a number of therapeutic modalities for the treatment and detection of hamartomas in PJS patients, and potential for the screening and treatment of the 30% of sporadic human lung cancers bearing LKB1 mutations.

The molecular mechanisms that underlie the tumor suppressor function of LKB1.

Germline mutations of the LKB1 tumor suppressor gene result in Peutz-Jeghers syndrome (PJS) characterized by intestinal hamartomas and increased incidence of epithelial cancers. Inactivating mutations in LKB1 have also been found in certain sporadic human cancers and with particularly high frequency in lung cancer. LKB1 has now been demonstrated to play a crucial role in pulmonary tumorigenesis, controlling initiation, differentiation, and metastasis. Recent evidences showed that LKB1 is a multitasking kinase, with great potential in orchestrating cell activity. Thus far, LKB1 has been found to play a role in cell polarity, energy metabolism, apoptosis, cell cycle arrest, and cell proliferation, all of which may require the tumor suppressor function of this kinase and/or its catalytic activity. This review focuses on remarkable recent findings concerning the molecular mechanism by which the LKB1 protein kinase operates as a tumor suppressor and discusses the rational treatment strategies to individuals suffering from PJS and other common disorders related to LKB1 signaling.

Genetic defects underlying Peutz-Jeghers syndrome (PJS) and exclusion of the polarity-associated MARK/Par1 gene family as potential PJS candidates.

LKB1/STK11 germline inactivations are identified in the majority (66-94%) of Peutz-Jeghers syndrome (PJS) patients. Therefore, defects in other genes or so far unidentified ways of LKB1 inactivation may cause PJS. The genes encoding the MARK proteins, homologues of the Par1 polarity protein that associates with Par4/Lkb1, were analyzed in this study because of their link to LKB1 and cell polarity. The genetic defect underlying PJS was determined through analysis of both LKB1 and all four MARK genes. LKB1 point mutations and small deletions were identified in 18 of 23 PJS families using direct sequencing and multiplex ligation-dependent probe amplification analysis identified exon deletions in 3 of 23 families. In total, 91% of the studied families showed LKB1 inactivation. Furthermore, a MARK1, MARK2, MARK3 and MARK4 mutation analysis and an MARK4 quantitative multiplex polymerase chain reaction analysis to identify exon deletions on another eight PJS families without identified LKB1 germline mutation did not identify mutations in the MARK genes. LKB1 defects are the major cause of PJS and genes of the MARK family do not represent alternative PJS genes. Other mechanisms of inactivation of LKB1 may cause PJS in the remaining families.

An updated mutation spectrum in an Australian series of PJS patients provides further evidence for only one gene locus.

The genetic predisposition Peutz-Jeghers Syndrome (PJS) has been shown to be associated with mutations in the serine threonine kinase 11 (STK11) gene but only a proportion of probands have been shown to harbour changes in the gene. The remaining patients were proposed to be either associated with a second PJS gene or they harboured more cryptic mutations within the STK11 gene itself. With the introduction of the multiplex ligation probe amplification (MLPA) assay, large sequence losses or gains can be more readily identified. In this report we have screened 33 PJS patients from unrelated families, employing a combination of denaturing high-performance liquid chromatography, direct DNA sequencing and the MLPA assay to identify deleterious changes in the STK11 gene. The results revealed that 24 (73%) of patients diagnosed with PJS-harboured pathogenic mutations in the STK11 gene, including 10 (36%) with exonic or whole-gene deletions. No phenotypic differences were identified in patients harbouring large deletions in the STK11 gene compared to patients harbouring missense or nonsense mutations. Mutation analysis in PJS should include techniques such as MLPA to identify large exonic or whole-gene deletions and rearrangements. The high proportion of families with identifiable mutations in the STK11 gene using this range of techniques suggests that most, if not all PJS, is attributable to mutations in the STK11 gene, perhaps including as yet undiscovered changes in promoter or enhancer sequences or other cryptic changes.

LKB1: a sweet side to Peutz-Jeghers syndrome?

The recent discovery that the tumour suppressor LKB1 is an upstream kinase in the AMP-activated protein kinase (AMPK) cascade provided a molecular link between energy metabolism and cancer. A recent study by Shaw and colleagues elucidated the role of LKB1 in type 2 diabetes. Deletion of the gene encoding LKB1 in the liver leads to marked hyperglycaemia as a consequence of increased gluconeogenic gene expression and hepatic glucose output. Importantly, the absence of LKB1 in the liver abolishes the effect of lowering glucose level caused by metformin, a drug that is widely used for the treatment of type 2 diabetes. These findings should help solve the mystery surrounding the function of metformin, which has lasted for >30 years.

Functional analysis of Peutz-Jeghers mutations reveals that the LKB1 C-terminal region exerts a crucial role in regulating both the AMPK pathway and the cell polarity.

Germline mutations of the LKB1 gene are responsible for the cancer-prone Peutz-Jeghers syndrome (PJS). LKB1 encodes a serine-threonine kinase that acts as a regulator of cell cycle, metabolism and cell polarity. The majority of PJS missense mutations abolish LKB1 enzymatic activity and thereby impair all functions assigned to LKB1. Here, we have investigated the functional consequences of recurrent missense mutations identified in PJS and in sporadic tumors which map in the LKB1 C-terminal non-catalytic region. We report that these C-terminal mutations neither disrupt LKB1 kinase activity nor interfere with LKB1-induced growth arrest. However, these naturally occuring mutations lessened LKB1-mediated activation of the AMP-activated protein kinase (AMPK) and impaired downstream signaling. Furthermore, C-terminal mutations compromise LKB1 ability to establish and maintain polarity of both intestinal epithelial cells and migrating astrocytes. Consistent with these findings, mutational analysis reveals that the LKB1 tail exerts an essential function in the control of cell polarity. Overall, our results ascribe a crucial regulatory role to the LKB1 C-terminal region. Our findings further indicate that LKB1 tumor suppressor activity is likely to depend on the regulation of AMPK signaling and cell polarization.

LKB1, the multitasking tumour suppressor kinase.

Mutations in the lkb1 gene are found in Peutz-Jeghers syndrome (PJS), with loss of heterozygosity or somatic mutations at the lkb1 locus, suggesting the gene product, the serine/threonine kinase LKB1, may function as a tumour suppressor. Patients with PJS are at a greater risk of developing cancers of epithelial tissue origin. It is widely accepted that the presence of hamartomatous polyps in PJS does not in itself lead to the development of malignancy. The signalling mechanisms that lead to these PJS related malignancies are not well understood. However, it is evident from the recent literature that LKB1 is a multitasking kinase, with unlimited potential in orchestrating cell activity. Thus far, LKB1 has been found to play a role in chromatin remodelling, cell cycle arrest, Wnt signalling, cell polarity, and energy metabolism, all of which may require the tumour suppressor function of this kinase and/or its catalytic activity.