Participation of the IL-10RB Related Cytokines, IL-22 and IFN-λ in Defense of the Airway Mucosal Barrier.

The airway epithelial barrier is a major barrier protecting against clinically significant infections of the lung. Its integrity is often compromised due to mechanical, chemical, or infectious causes. Opportunistic bacterial pathogens are poised to cause parenchymal infection and become difficult to eradicate due to adaptive metabolic changes, biofilm formation, and the acquisition of antimicrobial resistance and fitness genes. Enhancing mucosal defenses by modulating the cytokines that regulate barrier functions, such as interleukin-22 (IL-22) and interferon-λ (IFN-λ), members of the IL-10 family of cytokines, is an attractive approach to prevent these infections that are associated with high morbidity and mortality. These cytokines both signal through the cognate receptor IL-10RB, have related protein structures and common downstream signaling suggesting shared roles in host respiratory defense. They are typically co-expressed in multiple models of infections, but with differing kinetics. IL-22 has an important role in the producing antimicrobial peptides, upregulating expression of junctional proteins in the airway epithelium and working in concert with other inflammatory cytokines such as IL-17. Conversely, IFN-λ, a potent antiviral in influenza infection with pro-inflammatory properties, appears to decrease junctional integrity allowing for bacterial and immune cell translocation. The effects of these cytokines are pleotropic, with pathogen and tissue specific consequences. Understanding how these cytokines work in the mucosal defenses of the respiratory system may suggest potential targets to prevent invasive infections of the damaged lung.

Oral antibody to interleukin-10 receptor 2, but not interleukin-10 receptor 1, as an effective Eimeria species immunotherapy in broiler chickens.

Coccidiosis is a major gastrointestinal disease caused by several Eimeria species in floor raised chickens. Feeding an antibody to interleukin 10 (aIL-10) ameliorates the negative symptoms of coccidiosis in broilers, i.e., lack of weight gain, decreased feed conversion, and mortality. IL-10 signals by forming a ligand-receptor complex with IL-10 Receptor 1 (IL-10 R1) and IL-10 Receptor 2 (IL-10 R2). In this study, we hypothesize oral antibodies to the IL-10 receptors will neutralize the IL-10 signaling pathway equal to or better than aIL-10 to act as an oral anti-coccidiosis immunotherapy. A total of 5 sequential feed trials, set up as a 4 (diet antibody) × 2 (Eimeria challenge) factorial design, tested oral egg yolk antibodies to a total of 6 IL-10 R1 epitopes and 3 IL-10 R2 epitopes compared to a control antibody diet. A total of 10 pens of 5 chicks/pen/diet antibody/Eimeria challenge were housed for 21 d. On day 3 of age, chicks were either infected or not infected with a 10× dose of an Eimeria vaccine containing Eimeria acervulina, Eimeria tenella, and Eimeria maxima. Pen feed consumption and mean body weights were assessed weekly (d1, d7, d14, and d21); fecal oocyst shedding was assessed on day 10. Data were analyzed using a 2-way ANOVA. No significant interaction on chick weight was observed in chicks fed IL-10 R1 antibodies compared to chicks fed the control antibody was observed. In studies evaluating aIL-10 R2 oral antibodies, infected chicks fed aIL-10 R2: epitope 1 overcame the negative effects of Eimeria infection and had similar 21-d body weight to uninfected chicks (P4 = 0.07). We hypothesized that feeding oral antibodies to the IL-10 receptors would result in equivalent anti-coccidial benefits to aIL-10. However, none of the 6 antibodies to IL-10 R1 epitopes yielded any benefits during Eimeria infection compared to controls. A total of 2 oral antibodies to IL-10 R2 showed promising results equivalent to the aIL-10 immunotherapeutic. Immunofluorescence staining shows that the IL-10R2 significantly increases in abundance in response to Eimeria infection, whereas IL-10R1 does not.

Association of a PD-L2 Gene Polymorphism with Chronic Lymphatic Filariasis in a South Indian Cohort.

Lymphatic filariasis (LF) is a parasitic infection, caused by three closely related nematodes, namely Wuchereria bancrofti, Brugia malayi, and Brugia timori. Previously, we have shown that lysate from B. malayi microfilariae induces the expression of interleukin (IL)-10 and programmed death-ligand (PD-L) 1 on monocytes, which lead to inhibition of CD4+ T-cell responses. In this study, we investigated associations of IL-10 and programmed cell death (PD)-1 pathway gene polymorphisms with clinical manifestation in LF. We evaluated the frequency of alleles and genotypes of IL-10 (rs3024496, rs1800872), IL-10RA (rs3135932), IL-10RB (rs2834167), PD-1 (rs2227982, rs10204525), PD-L1 (rs4143815), PD-L2 (rs7854413), and single-nucleotide polymorphisms (SNPs) in 103 patients with chronic pathology (CP), such as elephantiasis or hydrocele and 106 endemic normal (EN) individuals from a South Indian population living in an area endemic for LF. Deviations from the Hardy-Weinberg equilibrium were tested, and we found a significant difference between the frequency of polymorphisms in PD-L2 (rs7854413; P < 0.001) and IL-10RB (rs2834167; P = 0.012) between the CP and the EN group, whereas there were no significant differences found among IL-10, IL-10RA, PD-1, and PD-L1 SNPs. A multivariate analysis showed that the existence of a CC genotype in PD-L2 SNP rs7854413 is associated with a higher risk of developing CP (OR: 2.942; 95% confidence interval [CI]: 0.957-9.046; P = 0.06). Altogether, these data indicate that a genetically determined individual difference in a non-synonymous missense SNP of PD-L2 might influence the susceptibility to CP.

Interleukin-22 promotes phagolysosomal fusion to induce protection against Salmonella enterica Typhimurium in human epithelial cells.

Intestinal epithelial cells (IECs) play a key role in regulating immune responses and controlling infection. However, the direct role of IECs in restricting pathogens remains incompletely understood. Here, we provide evidence that IL-22 primed intestinal organoids derived from healthy human induced pluripotent stem cells (hIPSCs) to restrict Salmonella enterica serovar Typhimurium SL1344 infection. A combination of transcriptomics, bacterial invasion assays, and imaging suggests that IL-22-induced antimicrobial activity is driven by increased phagolysosomal fusion in IL-22-pretreated cells. The antimicrobial phenotype was absent in hIPSCs derived from a patient harboring a homozygous mutation in the IL10RB gene that inactivates the IL-22 receptor but was restored by genetically complementing the IL10RB deficiency. This study highlights a mechanism through which the IL-22 pathway facilitates the human intestinal epithelium to control microbial infection.

Interleukin-26: An Emerging Player in Host Defense and Inflammation.

The production of interleukin (IL)-26 was initially attributed to T cells, and in particular to Th17 cells. However, more recent findings indicate IL-26 production in natural killer (NK) cells, macrophages and fibroblast-like cells as well. It is known that IL-26 binds to the IL-20R1/IL-10R2 receptor complex on certain target cells, where it causes specific intracellular signaling and the secretion of IL-1ß, IL-8 and TNF-α. In line with this type of proinflammatory role, IL-26 also increases chemotaxis of human neutrophils. Interestingly, high levels of IL-26 are present even in normal human airways, and endotoxin exposure further enhances these levels; this indicates involvement in antibacterial host defense. Studies on acute inflammatory disorders are few but there are studies showing the involvement of IL-26 in rheumatoid arthritis and inflammatory bowel disease. In conclusion, IL-26 is emerging as a potentially important player in host defense and may also be a pathogenic factor in the chronic inflammatory disorders of humans.

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

IL10R2 Overexpression Promotes IL22/STAT3 Signaling in Colorectal Carcinogenesis.

The mucosal immune response in the setting of intestinal inflammation contributes to colorectal cancer. IL10 signaling has a central role in gut homeostasis and is impaired in inflammatory bowel disease (IBD). Out of two IL10 receptor subunits, IL10R1 and IL10R2, the latter is shared among the IL10 family of cytokines and activates STAT signaling. STAT3 is oncogenic in colorectal cancer; however, knowledge about IL10 signaling upstream of STAT3 in colorectal cancer is lacking. Here, expression of IL10 signaling genes was examined in matched pairs from normal and tumor tissue from colorectal cancer patients showing overexpression (mRNA, protein) of IL10R2 and STAT3 but not IL10R1. IL10R2 overexpression was related to microsatellite stability. Transient overexpression of IL10R2 in HT29 cells increased proliferation upon ligand activation (IL10 and IL22). IL22, and not IL10, phosphorylated STAT3 along with increased phosphorylation of AKT and ERK. A significantly higher expression of IL22R1 and IL10R2 was also confirmed in a separate cohort of colorectal cancer samples. IL22 expression was elevated in gut mucosa from patients with IBD and colitis-associated cancer, which also exhibited increased expression of IL22R1 but not its coreceptor IL10R2. Overall, these data indicate that overexpression of IL10R2 and STAT3 contributes to colorectal carcinogenesis in microsatellite-stable tumors through IL22/STAT3 signaling.

Monogenic autoinflammatory diseases: Cytokinopathies.

Rapid advances in genetics are providing unprecedented insight into functions of the innate immune system with identification of the mutations that cause monogenic autoinflammatory disease. Cytokine antagonism is profoundly effective in a subset of these conditions, particularly those associated with increased interleukin-1 (IL-1) activity, the inflammasomopathies. These include syndromes where the production of IL-1 is increased by mutation of innate immune sensors such as NLRP3, upstream signalling molecules such as PSTPIP1 and receptors or downstream signalling molecules, such as IL-1Ra. Another example of this is interferon (IFN) and the interferonopathies, with mutations in the sensors STING and MDA5, the upstream signalling regulator AP1S3, and a downstream inhibitor of IFN signalling, ISG15. We propose that this can be extended to cytokines such as IL-36, with mutations in IL-36Ra, and IL-10, with mutations in IL-10RA and IL-10RB, however mutations in sensors or upstream signalling molecules are yet to be described in these instances. Additionally, autoinflammatory diseases can be caused by multiple cytokines, for example with the activation of NF-κB/Rel, for which we propose the term Relopathies. This nosology is limited in that some cytokine pathways may be degenerate in their generation or execution, however provides insight into likely autoinflammatory disease candidates and the cytokines with which newly identified mutations may be associated, and therefore targeted.

Identification of grass carp IL-10 receptor subunits: functional evidence for IL-10 signaling in teleost immunity.

Although the functions of teleost IL-10 have been preliminarily determined, functional evidence for its receptor signaling is lacking. Particularly, the identity of fish IL-10 receptor 2 (IL-10R2) is ambiguous. Cytokine receptor family member b4 (CRFB4) and CRFB5 are likely the ortholog of mammalian IL-10R2. In this study, grass carp CRFB4 (gcCRFB4) and gcCRFB5 cDNAs were isolated and characterized. The relatively high expression levels of grass carp IL10 receptor 1 (gcIL-10R1), gcCRFB4 and gcCRFB5 in immune tissues and cells implied their importance in fish immunity. Accordingly, gcIL-10R1, gcCRFB4 and gcCRFB5 were overexpressed in a grass carp kidney cell line to identify the IL-10 receptor subunits upon grass carp IL-10 (gcIL-10) treatment. Results showed that gcIL-10R1 was essential for gcIL-10 stimulation on STAT3 activation and grass carp suppressor of cytokine signaling 3 (gcSOCS3) promoter activity, and also indicated that gcCRFB4 but not gcCRFB5 might be the ortholog of mammalian IL-10R2. Furthermore, mutation of a putative STAT3-binding element in gcSOCS3 promoter attenuated the stimulation of gcIL-10 on gcSOCS3 promoter activity, indicating that gcIL-10 may modulate gcSOCS3 transcription at least partly via STAT3 activation. This notion was further supported by our observation that gcIL-10 was able to induce STAT3 phosphorylation and STAT3 inhibitor could abolish the upregulation of gcSOCS3 mRNA expression by gcIL-10 in grass carp head kidney leukocytes. Taken together, this study for the first time functionally characterized the teleost IL-10 receptor subunits and clarified the conservation of fish IL-10 signaling during evolution, thus laying the ground for further understanding the critical immune events led by IL-10 in teleost.

Ileal immune dysregulation in necrotizing enterocolitis: role of CD40/CD40L in the pathogenesis of disease.

OBJECTIVES: CD40, a co-stimulatory molecule, plays a critical role in coordinating enteric inflammatory immune responses. In necrotizing enterocolitis (NEC), upregulation of IL-10, a CD40-modulated cytokine, has been described, but the role of the IL-10 receptor (IL-10Rß), CD40, and its ligand CD40L in disease pathogenesis is unknown. The study herein investigates ileal expression of CD40, CD40L, and IL-10R in a rat model of NEC. SUBJECTS AND METHODS: NEC was induced in newborn rats using established methods of formula feeding, asphyxia, and cold stress. Expression of CD40, CD40L, IL-10Rß, and other proinflammatory molecules, including Toll-like receptor-4 (TLR-4) and IL-18, was assessed by immunoblotting. Tissue infiltration by macrophages, monocytes, and T cells was examined by confocal immunohistochemistry. RESULTS: Ileum from rat pups with NEC showed increased expression of TLR-4, IL-18, and IL-10Rß. Sections from both NEC and control pups demonstrated preservation of ileal cells expressing CD40/CD40L. The distal ileum of controls expressed both CD40 and CD40L; conversely, neither molecule was detected in ileal tissue from NEC pups. Additional studies showed that treatment with epidermal growth factor (EGF), previously shown to ameliorate the severity of NEC in an animal model, did not restore CD40 expression. CONCLUSIONS: Ileal cytokine dysregulation, manifested by decreased CD40/CD40L and increased IL-10Rß expression, may be involved in the pathogenesis of NEC. Dampened CD40 signaling may be related to enhanced IL-10 expression and a suppressed T-cell response to injury. We speculate that augmenting CD40-CD40L interactions may achieve a protective effect in this NEC model.

IL-10 within the CNS is necessary for CD4+ T cells to mediate neuroprotection.

We have previously shown that immunodeficient mice exhibit significant facial motoneuron (FMN) loss compared to wild-type (WT) mice after a facial nerve axotomy. Interleukin-10 (IL-10) is known as a regulatory cytokine that plays an important role in maintaining the anti-inflammatory environment within the central nervous system (CNS). IL-10 is produced by a number of different cells, including Th2 cells, and may exert an anti-apoptotic action on neurons directly. In the present study, the role of IL-10 in mediating neuroprotection following facial nerve axotomy in Rag-2- and IL-10-deficient mice was investigated. Results indicate that IL-10 is neuroprotective, but CD4+ T cells are not the requisite source of IL-10. In addition, using real-time PCR analysis of laser microdissected brainstem sections, results show that IL-10 mRNA is constitutively expressed in the facial nucleus and that a transient, significant reduction of IL-10 mRNA occurs following axotomy under immunodeficient conditions. Dual labeling immunofluorescence data show, unexpectedly, that the IL-10 receptor (IL-10R) is constitutively expressed by facial motoneurons, but is selectively induced in astrocytes within the facial nucleus after axotomy. Thus, a non-CD4+ T cell source of IL-10 is necessary for modulating both glial and neuronal events that mediate neuroprotection of injured motoneurons, but only with the cooperation of CD4+ T cells, providing an avenue of novel investigation into therapeutic approaches to prevent or reverse motoneuron diseases, such as amyotrophic lateral sclerosis (ALS).

Modulation of human plasmacytoid DC function by IFN-lambda1 (IL-29).

The type III family of IFNs displays immunomodulatory and antiviral activity. Each member (IFN-lambda1, -2, and -3) signals through the same heterodimeric receptor complex, which consists of the binding and signaling subunit (IL-28Ralpha) plus the IL-10Rbeta chain. Although the receptor has a wide tissue distribution, the direct effects of IFN-lambda on various immune cell subsets have not been fully characterized. We have identified high levels of IL-28Ralpha mRNA in pDC from peripheral blood and hypothesized that IFN-lambda plays an important role in pDC maturation and development. We show that stimulation of pDC with HSV or Imiquimod causes an increase in IL-28Ralpha mRNA. In these cells, IFN-lambda1 alters expression of the costimulatory molecules CD80 and ICOS-L and synergizes with IFN-alpha to up-regulate CD83. In addition, IFN-lambda1 has a variable effect on the homing molecule expression of pDC and mDC. IFN-lambda1-treated pDC display a marked difference in their ability to stimulate production of the signature cytokines IL-13, IFN-gamma, and IL-10 in a MLR. This work characterizes the variable effects of IFN-lambda on DC surface molecule expression and identifies a role in pDC activation and immunostimulatory potential.

Association of IL-10 and IL-10Rbeta gene polymorphisms with graft-versus-host disease after haematopoietic stem cell transplantation from an HLA-identical sibling donor.

BACKGROUND: Extensive allelic matching in the human leukocyte antigen (HLA) genes is regarded as a prerequisite for good clinical success of allogeneic haematopoietic stem cell transplantation (HSCT). Also other genetic factors can be assumed to play a role in preventing and controlling the complications associated with allogeneic HSCT, in particular graft-versus-host disease (GvHD). Interleukin-10 (IL-10) and its receptor (IL-10R), key regulators of the immune response, are among these candidates. We studied the association of IL-10 and IL-10Rbeta gene polymorphisms with the occurrence of GvHD in 309 HLA-identical sibling donor and recipient pairs. RESULTS: The difference in genotypic IL-10 production between patient and donor in combination with patient IL-10Rbeta A/A genotype predisposed strongly to acute GvHD (OR = 7.15, p = 0.000023). On the other hand, a combination of same genotypic IL-10 production with patient IL-10Rbeta A/A genotype protected from chronic GvHD (OR = 0.407, p = 0.0097). CONCLUSION: Our results suggest that IL-10 and IL-10Rbeta genes have a synergistic effect on the risk of GvHD.

Human interferon-lambda3 is a potent member of the type III interferon family.

Type III interferon (IFN) or IFN-lambda is a recently discovered family of IFNs that signal through the same downstream transcription factors as type I IFN but use a separate receptor complex composed of the IL-10R2 and the unique IFN-lambdaR1 receptor chains. We have established a simple and efficient expression system to produce highly pure and active IFN-lambda of the three human IFN-lambda isoforms (IFN-lambda1, -lambda2 and -lambda3) and used this to compare the biological activity of the different IFN-lambda subtypes. Surprisingly, we found IFN-lambda3 to possess the highest specific activity of the human IFN-lambda subtypes, exhibiting a twofold higher activity than IFN-lambda1 and a 16-fold higher activity than IFN-lambda2. Furthermore, in comparison with the commercially available preparations of IFN-lambda1 and -lambda2, we found our IFN-lambda preparation to be superior in activity.