Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 1.761
Filtrar
1.
Planta ; 255(6): 121, 2022 May 10.
Artigo em Inglês | MEDLINE | ID: mdl-35538157

RESUMO

MAIN CONCLUSION: The novel C-methyltransferase, MaMT1, could catalyze the conversion of piperidine to 2-methylpiperidine, which may be involved in the methylation step of DNJ biosynthesis in mulberry leaves. Mulberry (Morus alba L.) is a worldwide crop with medicinal, feeding and nutritional value, and 1-deoxynojirimycin ((2R, 3R, 4R, 5S)-2-hydroxymethyl-3, 4, 5-trihydroxypiperidine, DNJ) alkaloid, a potent α-glucosidase inhibitor, is its main active ingredient. Our previous researches clarified the biosynthetic pathway of DNJ from lysine to Δ1-piperideine, but its downstream pathway is unclear. Herein, eight differential methyltransferases (MTs) genes were screened from transcriptome profiles of mulberry leaves with significant differences in DNJ content (P < 0.01). Subsequently, MaMT1 (OM140666) and MaMT2 (OM140667) were hypothesized as candidate genes related to DNJ biosynthesis by correlation analysis of genes expression levels and DNJ content of mulberry leaves at different dates. Functional characterization of MaMT1 and MaMT2 were performed by cloning, prokaryotic expression and enzymatic reaction in vitro, and it showed that MaMT1 protein could catalyze the conversion of piperidine to 2-methylpiperidine. Moreover, molecular docking confirmed the interaction of MaMT1 protein with piperidine and S-adenosyl-L-methionine (SAM), indicating that MaMT1 had C-methyltransferase activity, while MaMT2 did not. The above results suggested that MaMT1 may be involved in the methylation step of DNJ alkaloid biosynthesis in mulberry leaves, which is a breakthrough in the analysis of DNJ alkaloid biosynthetic pathway. It is worth mentioning that the novel MaMT1, annotated as serine hydroxymethyltransferase, could rely on SAM to perform C-methyltransferase function. Therefore, our findings contribute new insights into the research of DNJ alkaloid biosynthesis and C-methyltransferase family.


Assuntos
Alcaloides , Morus , 1-Desoxinojirimicina/análise , 1-Desoxinojirimicina/metabolismo , 1-Desoxinojirimicina/farmacologia , Alcaloides/metabolismo , Clonagem Molecular , Metilação , Metiltransferases/genética , Metiltransferases/metabolismo , Simulação de Acoplamento Molecular , Morus/genética , Morus/metabolismo , Folhas de Planta/metabolismo , Transcriptoma
2.
Org Lett ; 24(15): 2935-2939, 2022 04 22.
Artigo em Inglês | MEDLINE | ID: mdl-35412834

RESUMO

Bacteria of the genus Massilia represent an underexplored source of bioactive natural products. Here, we report the discovery of massinidine (1), a guanidine alkaloid with antiplasmodial activity, from these microbes. The unusual scaffold of massinidine is shown to originate from l-phenylalanine, acetate, and l-arginine. Massinidine biosynthesis genes were identified in the native producer and validated through heterologous expression in Myxococcus xanthus. Bioinformatic analyses indicate that the potential for massinidine biosynthesis is distributed in various proteobacteria.


Assuntos
Alcaloides , Antimaláricos , Antineoplásicos , Myxococcus xanthus , Alcaloides/metabolismo , Alcaloides/farmacologia , Antimaláricos/farmacologia , Antineoplásicos/metabolismo , Proteínas de Bactérias/genética , Família Multigênica , Myxococcus xanthus/metabolismo
3.
Molecules ; 27(7)2022 Apr 06.
Artigo em Inglês | MEDLINE | ID: mdl-35408741

RESUMO

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.


Assuntos
Alcaloides , Ephedra , Metanfetamina , Alcaloides/metabolismo , Ephedra/genética , Ephedra/metabolismo , Efedrina/metabolismo , Humanos , Nucleotídeos , Extratos Vegetais
4.
New Phytol ; 234(4): 1394-1410, 2022 05.
Artigo em Inglês | MEDLINE | ID: mdl-35238413

RESUMO

Solanum steroidal glycoalkaloids (SGAs) are renowned defence metabolites exhibiting spectacular structural diversity. Genes and enzymes generating the SGA precursor pathway, SGA scaffold and glycosylated forms have been largely identified. Yet, the majority of downstream metabolic steps creating the vast repertoire of SGAs remain untapped. Here, we discovered that members of the 2-OXOGLUTARATE-DEPENDENT DIOXYGENASE (2-ODD) family play a prominent role in SGA metabolism, carrying out three distinct backbone-modifying oxidative steps in addition to the three formerly reported pathway reactions. The GLYCOALKALOID METABOLISM34 (GAME34) enzyme catalyses the conversion of core SGAs to habrochaitosides in wild tomato S. habrochaites. Cultivated tomato plants overexpressing GAME34 ectopically accumulate habrochaitosides. These habrochaitoside enriched plants extracts potently inhibit Puccinia spp. spore germination, a significant Solanaceae crops fungal pathogen. Another 2-ODD enzyme, GAME33, acts as a desaturase (via hydroxylation and E/F ring rearrangement) forming unique, yet unreported SGAs. Conversion of bitter α-tomatine to ripe fruit, nonbitter SGAs (e.g. esculeoside A) requires two hydroxylations; while the known GAME31 2-ODD enzyme catalyses hydroxytomatine formation, we find that GAME40 catalyses the penultimate step in the pathway and generates acetoxy-hydroxytomatine towards esculeosides accumulation. Our results highlight the significant contribution of 2-ODD enzymes to the remarkable structural diversity found in plant steroidal specialized metabolism.


Assuntos
Alcaloides , Dioxigenases , Lycopersicon esculentum , Solanum tuberosum , Solanum , Alcaloides/metabolismo , Dioxigenases/genética , Dioxigenases/metabolismo , Ácidos Cetoglutáricos/metabolismo , Lycopersicon esculentum/genética , Solanum/genética , Solanum/metabolismo , Solanum tuberosum/genética
5.
J Plant Physiol ; 271: 153641, 2022 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-35240512

RESUMO

Opium poppy is the only commercial source of the narcotic analgesics morphine and codeine, and semi-synthetic derivatives of the natural opiate precursor thebaine, including oxycodone and the opioid antagonist naloxone. The plant also accumulates the vasodilator and antitussive agents papaverine and noscapine, respectively, which together with morphine, codeine and thebaine comprise the major benzylisoquinoline alkaloids (BIAs) in opium poppy. A majority of enzymes involved in the highly branched BIA metabolism in opium poppy have now been discovered, with many specifically localized to sieve elements of the phloem based on immunofluorescence labeling techniques. Transcripts corresponding to sieve element-localized biosynthetic enzymes were detected in companion cells, as expected. The more recent application of shotgun proteomics has shown that several enzymes operating late in the morphine and noscapine biosynthetic pathways occur primarily in laticifers that are adjacent or proximal to sieve elements. BIA biosynthesis and accumulation in opium poppy involves three phloem cell types and implicates the translocation of key pathway intermediates between sieve elements and laticifers. The recent isolation of uptake transporters associated with laticifers supports an apoplastic rather than a symplastic route for translocation. In spite of the extensive elucidation of BIA biosynthetic enzymes in opium poppy, additional transporters and other auxiliary proteins are clearly necessary to support the complex spatial organization and dynamics involved in product formation and sequestration. In this review, we provide an update of BIA metabolism in opium poppy with a focus on the role of phloem in the biosynthesis of the major alkaloids.


Assuntos
Alcaloides , Benzilisoquinolinas , Papaver , Alcaloides/metabolismo , Benzilisoquinolinas/metabolismo , Vias Biossintéticas , Papaver/metabolismo , Floema/metabolismo
6.
Nutrients ; 14(5)2022 Feb 28.
Artigo em Inglês | MEDLINE | ID: mdl-35267998

RESUMO

The steroidal alkaloid tomatidine is an aglycone of α-tomatine, which is abundant in tomato leaves and has several biological activities. Tomatidine has been reported to inhibit the growth of cultured cancer cells in vitro, but its anti-cancer activity in vivo and inhibitory effect against gastric cancer cells remain unknown. We investigated the efficacy of tomatidine using human gastric cancer-derived 85As2 cells and its tumor-bearing mouse model and evaluated the effect of tomatidine-rich tomato leaf extract (TRTLE) obtained from tomato leaves. In the tumor-bearing mouse model, tumor growth was significantly inhibited by feeding a diet containing tomatidine and TRTLE for 3 weeks. Tomatidine and TRTLE also inhibited the proliferation of cultured 85As2 cells. Microarray data of gene expression analysis in mouse tumors revealed that the expression levels of mRNAs belonging to the type I interferon signaling pathway were altered in the mice fed the diet containing tomatidine and TRTLE. Moreover, the knockdown of one of the type I interferon-stimulated genes (ISGs), interferon α-inducible protein 27 (IFI27), inhibited the proliferation of cultured 85As2 cells. This study demonstrates that tomatidine and TRTLE inhibit the tumor growth in vivo and the proliferation of human gastric cancer-derived 85As2 cells in vitro, which could be due to the downregulation of ISG expression.


Assuntos
Alcaloides , Lycopersicon esculentum , Neoplasias Gástricas , Alcaloides/metabolismo , Alcaloides/farmacologia , Animais , Humanos , Interferons , Camundongos , Extratos Vegetais/farmacologia , Neoplasias Gástricas/tratamento farmacológico , Neoplasias Gástricas/genética , Tomatina/análogos & derivados
7.
Curr Opin Plant Biol ; 66: 102186, 2022 04.
Artigo em Inglês | MEDLINE | ID: mdl-35219143

RESUMO

Plants produce many compounds used by humans as medicines, including alkaloids of the benzylisoquinoline (BIA), monoterpene indole (MIA) and tropane classes. The biosynthetic pathways of these pharmaceutical alkaloids are complex and spatially segregated across several tissues, cell-types and organelles. This review discusses the origin of primary metabolic inputs required by these specialized biosynthetic pathways and considers aspects relevant to their spatial organization. These factors are important for alkaloid production both in the native plants and for synthetic biology pathway reconstruction in microorganisms.


Assuntos
Alcaloides , Vias Biossintéticas , Alcaloides/metabolismo , Plantas/metabolismo , Biologia Sintética
8.
Phytochemistry ; 197: 113125, 2022 May.
Artigo em Inglês | MEDLINE | ID: mdl-35157922

RESUMO

The filamentous fungi Fusarium sp. are well-known for their ability to produce abundant specialised metabolites with attractive chemical structures and bioactivities. In this study, chemical analyses of the endophyte F. equiseti D39 led to the isolation and identification of two pairs of undescribed 3-decalinoyltetramic acids (3DTAs) E/Z diastereomers, decalintetracids A and B. Their structures were elucidated by comprehensive spectroscopic analysis and quantum-chemical calculations. Although 3DTAs were commonly reported from fungi, decalintetracid A possessed an unprecedented tricyclo [7.2.1.02,7] dodecane skeleton, which added the diversity of these fungal metabolites. In addition, decalintetracid B was featured by a unique 6/6/5 ring system core. A plausible biosynthetic pathway for decalintetracids A and B was proposed. Both compounds exhibited phytotoxicity toward Amaranthus retroflexus L. and Amaranthus hybrid, indicating their potential as natural herbicides.


Assuntos
Alcaloides , Fusarium , Alcaloides/metabolismo , Endófitos , Fusarium/química , Pirrolidinonas
9.
Mar Environ Res ; 175: 105567, 2022 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-35123182

RESUMO

Cyanotoxins are among common contaminants that can impair human, animal, and environmental health. Cylindrospermopsin (CYN) is an abundant form of cyanotoxins elevated following algal bloom in the water worldwide. Previous studies have described CYN effects on several organs in mammals. However, little is known about its toxicity mechanisms in other vertebrates. This study aims to characterize the developmental effects of CYN using zebrafish larvae as an aquatic model organism. A wide range of CYN concentrations (0-2000 µg/L) was tested using a morphometric approach for survival, hatching, various growth and developmental abnormalities. We also investigated the expression of genes related to oxidative stress, osmoregulation, and thyroid function. Exposure to CYN resulted in decreased growth, increased developmental abnormalities such as pericardial and yolk sac edema as well as swim bladder absence. In addition, CYN increased tr1a, and decreased dio1 and dio3 transcript levels which are involved in thyroid-mediated function. It also increased transcript levels related to oxidative stress, including hsp70, ahr1a, cyp1a, gpx and cat. Lastly, CYN exposure increased aqp3a and decreased dab2, which are involved in osmoregulation with a threshold of 10 µg/L. The present study demonstrates multiple effects of exposure to environmentally relevant CYN concentrations in zebrafish embryos.


Assuntos
Alcaloides , Peixe-Zebra , Alcaloides/metabolismo , Alcaloides/toxicidade , Animais , Embrião não Mamífero , Desenvolvimento Embrionário , Peixe-Zebra/metabolismo
10.
Molecules ; 27(3)2022 Jan 25.
Artigo em Inglês | MEDLINE | ID: mdl-35164061

RESUMO

Human serum albumin (HSA) is the most abundant protein in plasma synthesized by the liver and the main modulator of fluid distribution between body compartments. It has an amazing capacity to bind with multiple ligands, offering a store and transporter for various endogenous and exogenous compounds. Huperzine A (HpzA) is a natural sesquiterpene alkaloid found in Huperzia serrata and used in various neurological conditions, including Alzheimer's disease (AD). This study elucidated the binding of HpzA with HSA using advanced computational approaches such as molecular docking and molecular dynamic (MD) simulation followed by fluorescence-based binding assays. The molecular docking result showed plausible interaction between HpzA and HSA. The MD simulation and principal component analysis (PCA) results supported the stable interactions of the protein-ligand complex. The fluorescence assay further validated the in silico study, revealing significant binding affinity between HpzA and HSA. This study advocated that HpzA acts as a latent HSA binding partner, which may be investigated further in AD therapy in experimental settings.


Assuntos
Alcaloides/metabolismo , Fármacos Neuroprotetores/metabolismo , Albumina Sérica Humana/metabolismo , Sesquiterpenos/metabolismo , Humanos , Ligação de Hidrogênio , Simulação de Acoplamento Molecular , Simulação de Dinâmica Molecular , Análise de Componente Principal , Ligação Proteica , Espectrometria de Fluorescência/métodos
11.
ChemMedChem ; 17(5): e202100784, 2022 03 04.
Artigo em Inglês | MEDLINE | ID: mdl-35001527

RESUMO

We report the synthesis of 16 new compounds obtained from kokusaginine and flindersiamine, the main alkaloids isolated from the bark of Balfourodendron riedelianum. The activity of the compounds against axenic cultures of Trypanosoma cruzi epimastigtotes and trypomastigotes, as well as intracellular amastigotes, is described, together with their cytotoxic activity against three different human cell lines. The synthetic strategy for the preparation of the new compounds was based on the reactivity at the C4 position of the furoquinoline core towards nucleophiles. The new derivatives were synthesized by a Buchwald-Hartwig reaction, in most cases under green, solvent-free conditions. Compounds 1 c and 1 e displayed better in-vitro activity against trypomastigotes than benznidazole and nifurtimox (positive controls) with IC50 <4 µM. In addition, both compounds were not cytotoxic against the three human cell lines K562 (erytroleukimia), LM2 (breast cancer), and HaCat (keratinocyte). Interestingly, when evaluated against intracellular amastigotes, compound 1 c was able to significantly reduce the number of this parasite form, compared to the negative control.


Assuntos
Alcaloides , Tripanossomicidas , Trypanosoma cruzi , Alcaloides/metabolismo , Alcaloides/farmacologia , Antiparasitários , Furanos , Humanos , Quinolinas
12.
Elife ; 112022 01 04.
Artigo em Inglês | MEDLINE | ID: mdl-34982029

RESUMO

Nicotinic partial agonists provide an accepted aid for smoking cessation and thus contribute to decreasing tobacco-related disease. Improved drugs constitute a continued area of study. However, there remains no reductionist method to examine the cellular and subcellular pharmacokinetic properties of these compounds in living cells. Here, we developed new intensity-based drug-sensing fluorescent reporters (iDrugSnFRs) for the nicotinic partial agonists dianicline, cytisine, and two cytisine derivatives - 10-fluorocytisine and 9-bromo-10-ethylcytisine. We report the first atomic-scale structures of liganded periplasmic binding protein-based biosensors, accelerating development of iDrugSnFRs and also explaining the activation mechanism. The nicotinic iDrugSnFRs detect their drug partners in solution, as well as at the plasma membrane (PM) and in the endoplasmic reticulum (ER) of cell lines and mouse hippocampal neurons. At the PM, the speed of solution changes limits the growth and decay rates of the fluorescence response in almost all cases. In contrast, we found that rates of membrane crossing differ among these nicotinic drugs by >30-fold. The new nicotinic iDrugSnFRs provide insight into the real-time pharmacokinetic properties of nicotinic agonists and provide a methodology whereby iDrugSnFRs can inform both pharmaceutical neuroscience and addiction neuroscience.


Assuntos
Alcaloides/química , Azepinas/química , Compostos Heterocíclicos de 4 ou mais Anéis/química , Agonistas Nicotínicos/química , Abandono do Hábito de Fumar , Alcaloides/metabolismo , Animais , Azocinas/química , Azocinas/metabolismo , Fluorescência , Humanos , Ligantes , Camundongos , Quinolizinas/química , Quinolizinas/metabolismo
13.
J Agric Food Chem ; 70(5): 1562-1570, 2022 Feb 09.
Artigo em Inglês | MEDLINE | ID: mdl-35080870

RESUMO

Histamine-based imidazole alkaloids N-caprylhistamine (HmC8) and N-caprylhistamine-ß-glucoside (HmC8-Glc) were recently identified as precursors for a tomato biomarker. As studies regarding metabolism and bioavailability are scarce, the present study aimed at the elucidation of intestinal absorption and metabolism using the Caco-2 model and the pig cecum model to mimic human intestinal conditions. The most abundant imidazole alkaloid HmC8-Glc was neither absorbed nor transferred across cellular barriers but extensively metabolized to HmC8 in the pig cecum model, whereas the aglycon HmC8 is subjected to transport and metabolic processes through the Caco-2 monolayer and metabolized to the bioactive neurotransmitter histamine by the intestinal microbiota. Deduced from the combined results of both methods, HmC8-Glc is not absorbed directly via the intestinal epithelium but requires a metabolic cleavage of the glycosidic bond by the gut microbiota. Because of the high bioavailability of the released HmC8 and histamine, HmC8 and its glucoside might also be involved in the intolerance to tomato products by histamine-intolerant consumers.


Assuntos
Alcaloides , Lycopersicon esculentum , Alcaloides/metabolismo , Animais , Células CACO-2 , Glucosídeos/metabolismo , Humanos , Imidazóis/metabolismo , Absorção Intestinal , Mucosa Intestinal/metabolismo , Suínos
14.
ACS Chem Biol ; 17(1): 187-197, 2022 01 21.
Artigo em Inglês | MEDLINE | ID: mdl-34994203

RESUMO

Strictosidine synthase (STR), the gate enzyme for monoterpenoid indole alkaloid biosynthesis, catalyzes the Pictet-Spengler reaction (PSR) of various tryptamine derivatives with secologanin assisted by "indole sandwich" stabilization. Continuous exploration with ß-methyltryptamine (IPA) stereoselectively delivered the C6-methylstrictosidines and C6-methylvincosides by enzymatic and nonenzymatic PSR, respectively. Unexpectedly, the first "nonindole sandwich" binding mode was witnessed by the X-ray structures of STR1-ligand complexes. Site-directed mutagenesis revealed the critical cryptic role of the hydroxyl group of Tyr151 in IPA biotransformation. Further computational calculations demonstrated the adjustable IPA position in STR1 upon the binding of secologanin, and Tyr151-OH facilitates the productive PSR binding mode via an advantageous hydrogen-bond network. Further chemo-enzymatic manipulation of C6-methylvincosides successfully resulted in the discovered antimalarial framework (IC50 = 0.92 µM).


Assuntos
Alcaloides/metabolismo , Carbolinas/metabolismo , Carbono-Nitrogênio Liases/metabolismo , Triptaminas/metabolismo , Alcaloides/química , Antineoplásicos/química , Antineoplásicos/farmacologia , Carbolinas/química , Carbono-Nitrogênio Liases/genética , Domínio Catalítico , Sobrevivência Celular/efeitos dos fármacos , Células HL-60 , Humanos , Modelos Moleculares , Estrutura Molecular , Ligação Proteica , Conformação Proteica , Triptaminas/química , p-Hidroxianfetamina
15.
Sci Rep ; 12(1): 111, 2022 01 07.
Artigo em Inglês | MEDLINE | ID: mdl-34997061

RESUMO

Opium poppy (Papaver somniferum) is one of the world's oldest medicinal plants and a versatile model system to study secondary metabolism. However, our knowledge of its genetic diversity is limited, restricting utilization of the available germplasm for research and crop improvement. We used genotyping-by-sequencing to investigate the extent of genetic diversity and population structure in a collection of poppy germplasm consisting of 91 accessions originating in 30 countries of Europe, North Africa, America, and Asia. We identified five genetically distinct subpopulations using discriminate analysis of principal components and STRUCTURE analysis. Most accessions obtained from the same country were grouped together within subpopulations, likely a consequence of the restriction on movement of poppy germplasm. Alkaloid profiles of accessions were highly diverse, with morphine being dominant. Phylogenetic analysis identified genetic groups that were largely consistent with the subpopulations detected and that could be differentiated broadly based on traits such as number of branches and seed weight. These accessions and the associated genotypic data are valuable resources for further genetic diversity analysis, which could include definition of poppy core sets to facilitate genebank management and use of the diversity for genetic improvement of this valuable crop.


Assuntos
DNA de Plantas/genética , Genes de Plantas , Variação Genética , Genoma de Planta , Técnicas de Genotipagem , Papaver/genética , Polimorfismo de Nucleotídeo Único , Sementes/genética , Análise de Sequência de DNA , Alcaloides/metabolismo , Genótipo , Papaver/crescimento & desenvolvimento , Papaver/metabolismo , Fenótipo , Filogenia , Sementes/crescimento & desenvolvimento , Sementes/metabolismo
16.
Mol Biol Rep ; 49(4): 2667-2675, 2022 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-35059967

RESUMO

BACKGROUND: In the alkaloid biosynthetic pathways of Stephania and Rannunculaceae, columbamine O-methyltransferase (CoOMT) is an important enzyme that catalyses the formation of the tetrahydropalmatin (rotundin) biosynthesis pathway. In this study, the transgenic construct pBI121-35S-CoOMT-cmyc-Kdel was designed successfully. METHODS AND RESULTS: The real-time RT-PCR results proved that the CoOMT transgene was successfully introduced into Nicotiana tabacum L. plants and produced mRNA. Its transcription levels in three transgenic tobacco lines, T0-7, T0-9, and T0-20, in the T0 generation were higher than those in wild-type tobacco plants. By analysing Western blots and ELISAs, three T0 generation transgenic tobacco lines also expressed recombinant CoOMT (rCoOMT) protein with a molecular weight of approximately 40 kDa, and its contents ranged from 0.048 µg mg-1 to 0.177 µg mg-1. These data illustrated that the CoOMT transgene was expressed; thus, the rCoOMT protein synthesis efficiency increased significantly in comparison with that of the wild-type tobacco plants. The total alkaloid contents ranged from 2.12 g 100 g-1 (of dry weight) to 3.88 g 100 g-1 (of dry weight). The T0-20 plant had the highest total alkaloid content (3.88 g 100 g-1 of dry weight), followed by the T0-7 line (2.75 g 100 g-1 of dry weight). The total alkaloid contents of the CoOMT transgenic tobacco lines increased by approximately 1.09-1.83-fold compared to the wild-type tobacco plants. CONCLUSIONS: This is the first study on the transformation and expression of the CoOMT gene in N. tabacum plants. Initial results of the analysis of transgenic plants proved that the transgenic structure pBI121- CoOMT-Cmyc-Kdel can be used for transformation into Stephania plants.


Assuntos
Alcaloides , Tabaco , Alcaloides/genética , Alcaloides/metabolismo , Alcaloides de Berberina , Metiltransferases/genética , Metiltransferases/metabolismo , Plantas Geneticamente Modificadas/genética , Plantas Geneticamente Modificadas/metabolismo , Tabaco/genética , Tabaco/metabolismo
17.
Biomed Chromatogr ; 36(1): e5235, 2022 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-34553391

RESUMO

Dingkun Dan (DKD), a reputable traditional Chinese medicine formula, has been used to treat gynecological diseases and showed significant clinical effects since ancient times. However, the application and development of DKD are seriously hampered by the unclear active substances. Structural characterization of compounds absorbed in vivo and their corresponding metabolites is significant for clarifying the pharmacodynamic material basis. In this study, an integrated strategy using ultra-performance liquid chromatography, coupled with quadrupole time-of-flight mass spectrometry and UNIFI™ software, was used to identify prototypes and metabolites after oral administration of DKD in rats. As a result, a total of 261 compounds, including 140 prototypes and 121 metabolites, were tentatively characterized in rat plasma, urine, and feces. The metabolic pathways of prototypes have been studied to clarify their possible transformation process in vivo. Moreover, an in vitro metabolism study was applied for verifying the metabolites under simulating the metabolic environment in vivo. This first systematic metabolic study of DKD is important for elucidating the metabolites and metabolic pathways and could provide a scientific basis for explaining the integrative mechanism in further pharmacology study.


Assuntos
Cromatografia Líquida de Alta Pressão/métodos , Medicamentos de Ervas Chinesas/química , Medicamentos de Ervas Chinesas/metabolismo , Espectrometria de Massas/métodos , Administração Oral , Alcaloides/análise , Alcaloides/química , Alcaloides/metabolismo , Animais , Medicamentos de Ervas Chinesas/administração & dosagem , Flavonoides/análise , Flavonoides/química , Flavonoides/metabolismo , Redes e Vias Metabólicas , Ratos , Saporinas/análise , Saporinas/química , Saporinas/metabolismo
18.
New Phytol ; 233(3): 1220-1237, 2022 02.
Artigo em Inglês | MEDLINE | ID: mdl-34758118

RESUMO

Steroidal glycoalkaloids (SGAs) are protective metabolites constitutively produced by Solanaceae species. Genes and enzymes generating the vast structural diversity of SGAs have been largely identified. Yet, mechanisms of hormone pathways coordinating defence (jasmonate; JA) and growth (gibberellin; GA) controlling SGAs metabolism remain unclear. We used tomato to decipher the hormonal regulation of SGAs metabolism during growth vs defence tradeoff. This was performed by genetic and biochemical characterisation of different JA and GA pathways components, coupled with in vitro experiments to elucidate the crosstalk between these hormone pathways mediating SGAs metabolism. We discovered that reduced active JA results in decreased SGA production, while low levels of GA or its receptor led to elevated SGA accumulation. We showed that MYC1 and MYC2 transcription factors mediate the JA/GA crosstalk by transcriptional activation of SGA biosynthesis and GA catabolism genes. Furthermore, MYC1 and MYC2 transcriptionally regulate the GA signalling suppressor DELLA that by itself interferes in JA-mediated SGA control by modulating MYC activity through protein-protein interaction. Chemical and fungal pathogen treatments reinforced the concept of JA/GA crosstalk during SGA metabolism. These findings revealed the mechanism of JA/GA interplay in SGA biosynthesis to balance the cost of chemical defence with growth.


Assuntos
Alcaloides , Lycopersicon esculentum , Alcaloides/metabolismo , Ciclopentanos/metabolismo , Regulação da Expressão Gênica de Plantas , Giberelinas/metabolismo , Lycopersicon esculentum/metabolismo , Oxilipinas/metabolismo
19.
Fitoterapia ; 156: 105085, 2022 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-34793883

RESUMO

Four new iboga-type alkaloids, ervaoffines H-K (1-4), along with five known compounds were obtained from the aerial parts of Ervatamia officinalis. The absolute configurations of 1-4 were confirmed by X-ray diffraction and electronic circular dichroism (ECD) analyses. The isolates were tested for their anti-inflammatory activity. Compounds 1, 5, 6, and 9 showed potential inhibitory effect of NO production in LPS-stimulated BV2 and RAW264.7 cells.


Assuntos
Alcaloides/metabolismo , Anti-Inflamatórios/metabolismo , Tabernaemontana/química , Alcaloides/química , Alcaloides/isolamento & purificação , Alcaloides/farmacologia , Anti-Inflamatórios/química , Anti-Inflamatórios/isolamento & purificação , Anti-Inflamatórios/farmacologia , Cristalografia por Raios X , Concentração Inibidora 50 , Espectroscopia de Ressonância Magnética , Estrutura Molecular , Espectrofotometria Ultravioleta , Espectroscopia de Infravermelho com Transformada de Fourier
20.
Fitoterapia ; 156: 105086, 2022 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-34798164

RESUMO

Two new isoquinoline alkaloids, cryptowrayines A (1) and B (2), along with one known pavine alkaloid (-)-12-hydroxyeschscholtzidine (3), were isolated from the twigs of Cryptocarya wrayi. The structures of new compounds were elucidated by extensive spectroscopic data analysis and electronic circular dichroism (ECD) calculations. Both compounds 1 and 2 exhibited moderate quinone reductase inducing activity in Hepa 1c1c7 cells.


Assuntos
Alcaloides/isolamento & purificação , Cryptocarya/química , Isoquinolinas/isolamento & purificação , Alcaloides/química , Alcaloides/metabolismo , Glucosidases/antagonistas & inibidores , Inibidores de Glicosídeo Hidrolases/química , Inibidores de Glicosídeo Hidrolases/isolamento & purificação , Inibidores de Glicosídeo Hidrolases/metabolismo , Concentração Inibidora 50 , Isoquinolinas/química , Isoquinolinas/metabolismo , Espectroscopia de Ressonância Magnética , Estrutura Molecular , NAD(P)H Desidrogenase (Quinona)/análise , Rotação Ocular
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...