Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 81.939
Filtrar
1.
Clin Lab ; 70(4)2024 Apr 01.
Artigo em Inglês | MEDLINE | ID: mdl-38623656

RESUMO

BACKGROUND: Evaluation of biomarkers as risk factors for mortality may provide early intervention and treatment for fatal diseases. We aimed to determine the usability of inexpensive and easily measurable tests in the differentiation of critically ill patients by investigating their relationship with mortality. METHODS: This study was executed by examining the sixth, third, and first month examinations of patients registered to the home health care services unit in 2022 before mortality due to any reason. This study was conducted by including 1,060 patients. All parameters were distributed non-parametrically. The difference between the dependent groups was evaluated with Friedman's two-way analysis of variance, and p < 0.05 was considered statistically significant. RESULTS: When the patients' premortem one-month, three-month, and six-month results were examined, there was an increase in mean platelet volume (MPV) values over time. The neutrophil-to-lymphocyte ratio (NLR) and platelet-to-lymphocyte ratio (PLR) also increased. In these two parameters, the difference between the first and third months and between the first and sixth months was statistically significant. Given the C-Reactive Protein (CRP)/Albumin Ratio (CAR) and CRP/Prealbumin results, a significant increase was observed in both ratios. A more than four-fold increase was observed in the CAR between the premortem first and sixth month results, which increased gradually over time and was statistically significant. Conclusions: NLR, PLR, MPV, CAR and CRP/Prealbumin values were statistically associated with mortality.


Assuntos
Plaquetas , Pré-Albumina , Humanos , Pré-Albumina/metabolismo , Contagem de Plaquetas , Plaquetas/metabolismo , Linfócitos/metabolismo , Biomarcadores/metabolismo , Neutrófilos/metabolismo , Proteína C-Reativa/análise , Estudos Retrospectivos
2.
Clin Lab ; 70(4)2024 Apr 01.
Artigo em Inglês | MEDLINE | ID: mdl-38623668

RESUMO

BACKGROUND: Platelet (PLT) count is one of the most important parameters of automated hematology, as spurious PLT reports could affect medical judgement and bring significant risks. In most cases, spurious PLT will not be reported for review criteria, which will be triggered by abnormal PLT histograms and PLT flag(s). Here, we present a case of severe aplastic anemia after hematopoietic stem cell transplantation with spurious high platelet count with normal histogram and no PLT flag(s). METHODS: The electrical impedance channel (PLT-I) and the fluorescence channel (PLT-F) of Sysmex XN-series hematology analyzer was used to obtain PLT results. Then, the sample was retested by another hematology analyzer MINDRAY BC-7500 [NR] CRP, and incubation was performed to rule out cryoglobulin interference. Furthermore, a microscope was used to estimate the PLT count by the ratio of platelets to red blood cells and observe the morphology of cells. RESULTS: Both PLT-I and PLT-F test results were spuriously high, and microscopically assessed platelet counts were relatively reliable. The observed spiny cells and ghost cells caused by hemolysis may have contributed to the inaccuracy of instrumental counting in this case. CONCLUSIONS: For special hematologic patients, PLT-I with flags may not be sufficient for screening purposes and PLT-F is not always accurate. Multiple testing methods including manual microscopy are needed.


Assuntos
Agmatina/análogos & derivados , Anemia Aplástica , Ácido Oxâmico/análogos & derivados , Humanos , Contagem de Plaquetas/métodos , Anemia Aplástica/diagnóstico , Reprodutibilidade dos Testes , Plaquetas
3.
BMC Oral Health ; 24(1): 461, 2024 Apr 16.
Artigo em Inglês | MEDLINE | ID: mdl-38627719

RESUMO

BACKGROUND: It is uncertain if mean platelet volume and periodontitis are related. The objective of this study was to examine the association between levels of mean platelet volume and moderate/severe periodontitis in adult persons who inhabit the U.S. METHODS: We screened 6,809 people from the National Health and Nutrition Examination Survey (NHANES 2009-2012). Mean platelet volume was measured in the Mobile Examination Centers (MECs) using the Beckman Coulter analyzer. The category of periodontitis was defined by the CDC/AAP using clinical periodontal parameters. Multiple logistic regression models were employed to examine the distribution for covariate differences across the various independent groups. Four models were employed to examine the relationship between mean platelet volume level and periodontitis. Smoothed curve fitting was utilized to confirm the linearity of the relationships. To determine the impact of factors on the connection between MPV and periodontitis, subgroup analysis and interaction testing were utilized. RESULTS: Results from the multiple logistic regression analysis indicate a significant association between moderate/severe periodontitis and the mean platelet level, even after considering any potential confounding variables (OR = 1.090, 95% CI: 1.019-1.166, P-value = 0.01211). Additionally, those in the upper tertile of mean platelet volume levels had a 21.6% higher probability of developing periodontitis when compared with those in the least tertile of mean platelet levels (OR = 1.216, 95% CI:1.052-1.406, P-value = 0.00816). Moreover, it showed a positive correlation between mean platelet volume (MPV) and moderate/severe periodontitis. Subgroup analyses indicated a positive association between the level of mean platelet volume and moderate/severe periodontitis among individuals who were under 60 years of age, had low income, were obese, never smoked, were heavy drinkers, had hypertension, and had no cardiovascular disease (p < 0.05). However, none of the subgroups exhibited significant interactions (p for interaction > 0.05). CONCLUSION: A correlation has been found between mean platelet volume levels and periodontal disease in individuals residing in the United States.


Assuntos
Volume Plaquetário Médio , Periodontite , Adulto , Humanos , Estados Unidos , Estudos Transversais , Inquéritos Nutricionais , Plaquetas
4.
Platelets ; 35(1): 2334701, 2024 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-38630016

RESUMO

Platelets are terminally differentiated anucleated cells, but they still have cell-like functions and can even produce progeny platelets. However, the mechanism of platelet sprouting has not been elucidated so far. Here, we show that when platelet-rich plasma(PRP) was cultured at 37°C, platelets showed a spore phenomenon. The number of platelets increased when given a specific shear force. It is found that AMP-related signaling pathways, such as PKA and AMPK are activated in platelets in the spore state. Meanwhile, the mRNA expression levels of genes, such as CNN3, CAPZB, DBNL, KRT19, and ESPN related to PLS1 skeleton proteins also changed. Moreover, when we use the AMPK activator AICAR(AI) to treat washed platelets, cultured platelets can still appear spore phenomenon. We further demonstrate that washed platelets treated with Forskolin, an activator of PKA, not only platelet sprouting after culture but also the AMPK is activated. Taken together, these data demonstrate that AMPK plays a key role in the process of platelet budding and proliferation, suggesting a novel strategy to solve the problem of clinical platelet shortage.


What is new? In this study, we showed that when platelet-rich plasma(PRP) was cultured at 37°C, platelets showed spore phenomenon and increased.It was found that AMP-related signaling pathways, such as PKA and AMPK were activated in platelets in the spore state.In addition, we found that PKA acts as an upstream kinase of AMPK.In the process of platelet sprouting and proliferation, the mRNA expression levels of skeleton protein PLS1 and its related genes, such as CNN3, CAPZB, DBNL, KRT19, andESPN also changed.What is the impact? Our study proposes a new strategy to solve the problem of clinical platelet shortage.


Assuntos
Proteínas Quinases Ativadas por AMP , Plaquetas , Humanos , Compostos Radiofarmacêuticos , Diferenciação Celular , Colforsina
5.
Int J Mol Sci ; 25(7)2024 Mar 28.
Artigo em Inglês | MEDLINE | ID: mdl-38612585

RESUMO

Hypercortisolism is known to affect platelet function. However, few studies have approached the effect of exogenous cortisol on human platelets, and the results obtained are conflicting and unconvincing. In this study, the effect of exogenous cortisol on several parameters indicative of oxidative status in human platelets has been analysed. We have found that cortisol stimulates ROS production, superoxide anion formation, and lipid peroxidation, with these parameters being in strict correlation. In addition, cortisol decreases GSH and membrane SH-group content, evidencing that the hormone potentiates oxidative stress, depleting platelet antioxidant defence. The involvement of src, syk, PI3K, and AKT enzymes in oxidative mechanisms induced by cortisol is shown. The main sources of ROS in cells can include uncontrolled increase of NADPH oxidase activity and uncoupled aerobic respiration during oxidative phosphorylation. Both mechanisms seem to be involved in ROS formation induced by cortisol, as the NADPH oxidase 1 inhibitor 2(trifluoromethyl)phenothiazine, and rotenone and antimycin A, complex I and III inhibitor, respectively, significantly reduce oxidative stress. On the contrary, the NADPH oxidase inhibitor gp91ds-tat, malate and NaCN, complex II and IV inhibitor, respectively, have a minor effect. It is likely that, in human platelets, oxidative stress induced by cortisol can be associated with venous and arterial thrombosis, greatly contributing to cardiovascular diseases.


Assuntos
Hidrocortisona , Estresse Oxidativo , Humanos , Hidrocortisona/farmacologia , Espécies Reativas de Oxigênio , Plaquetas , NADPH Oxidases
6.
Int J Mol Sci ; 25(7)2024 Apr 03.
Artigo em Inglês | MEDLINE | ID: mdl-38612792

RESUMO

The role of antiplatelet therapy in patients with acute coronary syndromes is a moving target with considerable novelty in the last few years. The pathophysiological basis of the treatment depends on platelet biology and physiology, and the interplay between these aspects and clinical practice must guide the physician in determining the best therapeutic options for patients with acute coronary syndromes. In the present narrative review, we discuss the latest novelties in the antiplatelet therapy of patients with acute coronary syndromes. We start with a description of platelet biology and the role of the main platelet signal pathways involved in platelet aggregation during an acute coronary syndrome. Then, we present the latest evidence on the evaluation of platelet function, focusing on the strengths and weaknesses of each platelet's function test. We continue our review by describing the role of aspirin and P2Y12 inhibitors in the treatment of acute coronary syndromes, critically appraising the available evidence from clinical trials, and providing current international guidelines and recommendations. Finally, we describe alternative therapeutic regimens to standard dual antiplatelet therapy, in particular for patients at high bleeding risk. The aim of our review is to give a comprehensive representation of current data on antiplatelet therapy in patients with acute coronary syndromes that could be useful both for clinicians and basic science researchers to be up-to-date on this complex topic.


Assuntos
Síndrome Coronariana Aguda , Humanos , Síndrome Coronariana Aguda/tratamento farmacológico , Inibidores da Agregação Plaquetária/uso terapêutico , Aspirina/uso terapêutico , Plaquetas , Agregação Plaquetária
7.
Int J Mol Sci ; 25(7)2024 Apr 04.
Artigo em Inglês | MEDLINE | ID: mdl-38612827

RESUMO

The signaling lymphocytic activation molecule (SLAM) receptor family (SLAMF) consists of nine glycoproteins that belong to the CD2 superfamily of immunoglobulin (Ig) domain-containing molecules. SLAMF receptors modulate the differentiation and activation of a wide range of immune cells. Individual SLAMF receptors are expressed on the surface of hematopoietic stem cells, hematopoietic progenitor cells, B cells, T cells, NK cells, NKT cells, monocytes, macrophages, dendritic cells, neutrophils, and platelets. The expression of SLAMF receptors was studied during normal B cell maturation. Several SLAMF receptors were also detected in cancer cell lines of B-lymphoid origin and in pathological B cells from patients with B cell chronic lymphoproliferative disorders (B-CLPD), the most frequent hematological malignancies in adults. This review summarizes current knowledge on the expression of SLAMF receptors and their adaptor proteins SAP and EAT-2 in B-CLPD. Several SLAMF receptors could be regarded as potential diagnostic and differential diagnostic markers, prognostic factors, and targets for the development of novel drugs for patients with B-CLPD.


Assuntos
Proteínas Adaptadoras de Transdução de Sinal , Transtornos Linfoproliferativos , Adulto , Humanos , Linfócitos B , Plaquetas , Família de Moléculas de Sinalização da Ativação Linfocitária/genética , Transtornos Linfoproliferativos/genética
8.
Int J Mol Sci ; 25(7)2024 Apr 06.
Artigo em Inglês | MEDLINE | ID: mdl-38612879

RESUMO

Although fibrin matrices derived from Platelet-Rich Plasma (PRP) are widely used in regenerative medicine, they have some limitations that can hinder their application. Modifying the composition of the PRP-derived fibrin matrix may improve its properties, making it suitable for certain medical uses. Three types of fibrin matrices were obtained: a PRP-derived fibrin matrix (FM), a PRP-derived fibrin matrix with a high fibrinogen content and platelets (FM-HFP) and a PRP-derived fibrin matrix with a high fibrinogen content (FM-HF). The fibrinogen levels, biomechanical properties and cell behavior were analyzed. The presence of platelets in the FM-HFP generated an inconsistent fibrin matrix that was discarded for the rest of the analysis. The fibrinogen levels in the FM-FH were higher than those in the FM (p < 0.0001), with a concentration factor of 6.86 ± 1.81. The values of clotting and swelling achieved using the FM-HF were higher (p < 0.0001), with less clot shrinkage (p < 0.0001). The FM had a significantly higher stiffness and turned out to be the most adherent composition (p = 0.027). In terms of cell viability, the FM-HF showed less cell proliferation but higher live/dead ratio values (p < 0.01). The increased fibrinogen and platelet removal in the FM-HF improved its adhesion and other biomechanical properties without affecting cell viability.


Assuntos
Plasma Rico em Plaquetas , Coagulação Sanguínea , Plaquetas , Fibrina , Fibrinogênio
9.
Arch Iran Med ; 27(2): 89-95, 2024 Feb 01.
Artigo em Inglês | MEDLINE | ID: mdl-38619032

RESUMO

BACKGROUND: Blood wastage leads to additional costs and reduced blood availability to patients. Above all is the moral issue of wasting donor gifts. This study aimed to determine the rate of blood wastage before and after implementing a new standard operating procedure (SOP) in Iran. METHODS: In this interventional study, a SOP for wastage management was prepared and implemented in all blood centers throughout the country. Data were extracted from the integrated software of the Iranian Blood Transfusion Organization (IBTO). The wastage rate of blood components in the post-intervention years (2016-2017) was then compared with that in the pre-intervention years (2013-2015) using the Z test. RESULTS: The overall wastage rate decreased by 36.86% (P<0.001, 95% CI [36.84-36.88]) after the intervention. Red blood cell (RBC) wastage decreased from 2.6% to 2.5%, platelet wastage from 19.5% to 10.6% and plasma wastage from 15.5% to 7.3% (P<0.001). The highest percentage of waste reduction pertained to plasma components, which decreased by 52.90% (P<0.001, 95% CI [52.86-52.94]). Expiration was the most common cause of RBC and platelet wastage. The most common causes of plasma wastage were RBC contamination and rupture or leakage of the bags. The intervention resulted in a drop of over 250000 discarded components each year, equal to approximately thirty-six million dollars in savings. CONCLUSION: This intervention effectively reduced waste and increased efficiency. Ongoing blood wastage reviews, auditing, and receiving feedback from the central headquarters were powerful tools in following the compliance of blood centers. Further studies are recommended, especially concerning blood wastage in hospital blood banks and various wards.


Assuntos
Plaquetas , Hospitais , Humanos , Irã (Geográfico) , Cooperação do Paciente
11.
Sci Rep ; 14(1): 8534, 2024 04 12.
Artigo em Inglês | MEDLINE | ID: mdl-38609394

RESUMO

CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.


Assuntos
Transtornos Plaquetários , Antígenos CD36 , Humanos , Antígenos CD36/genética , Plaquetas , Bases de Dados Factuais , RNA
12.
Sci Transl Med ; 16(742): eadi4490, 2024 Apr 10.
Artigo em Inglês | MEDLINE | ID: mdl-38598613

RESUMO

Uncontrolled bleeding after trauma represents a substantial clinical problem. The current standard of care to treat bleeding after trauma is transfusion of blood products including platelets; however, donated platelets have a short shelf life, are in limited supply, and carry immunogenicity and contamination risks. Consequently, there is a critical need to develop hemostatic platelet alternatives. To this end, we developed synthetic platelet-like particles (PLPs), formulated by functionalizing highly deformable microgel particles composed of ultralow cross-linked poly (N-isopropylacrylamide) with fibrin-binding ligands. The fibrin-binding ligand was designed to target to wound sites, and the cross-linking of fibrin polymers was designed to enhance clot formation. The ultralow cross-linking of the microgels allows the particles to undergo large shape changes that mimic platelet shape change after activation; when coupled to fibrin-binding ligands, this shape change facilitates clot retraction, which in turn can enhance clot stability and contribute to healing. Given these features, we hypothesized that synthetic PLPs could enhance clotting in trauma models and promote healing after clotting. We first assessed PLP activity in vitro and found that PLPs selectively bound fibrin and enhanced clot formation. In murine and porcine models of traumatic injury, PLPs reduced bleeding and facilitated healing of injured tissue in both prophylactic and immediate treatment settings. We determined through biodistribution experiments that PLPs were renally cleared, possibly enabled by ultrasoft particle properties. The performance of synthetic PLPs in the preclinical studies shown here supports future translational investigation of these hemostatic therapeutics in a trauma setting.


Assuntos
Hemostáticos , Roedores , Animais , Camundongos , Suínos , Roedores/metabolismo , Distribuição Tecidual , Plaquetas/metabolismo , Hemorragia , Fibrina/química , Fibrina/metabolismo
14.
BMC Cancer ; 24(1): 399, 2024 Apr 01.
Artigo em Inglês | MEDLINE | ID: mdl-38561690

RESUMO

BACKGROUND: Podoplanin (PDPN) expressed on tumour cells interacts with platelet C-type lectin-like receptor 2 (CLEC-2). This study aimed to investigate the role of the PDPN-platelet CLEC-2 interaction in melanoma pulmonary metastasis. METHODS: Murine melanoma B16-F0 cells, which have two populations that express podoplanin, were sorted by FACS with anti-podoplanin staining to obtain purified PDPN + and PDPN- B16-F0 cells. C57BL/6J mice transplanted with CLEC-2-deficient bone marrow cells were used for in vivo experiments. RESULTS: The in vivo data showed that the number of metastatic lung nodules in WT mice injected with PDPN + cells was significantly higher than that in WT mice injected with PDPN- cells and in WT or CLEC-2 KO mice injected with PDPN- cells. In addition, our results revealed that the platelet Syk-dependent signalling pathway contributed to platelet aggregation and melanoma metastasis. CONCLUSIONS: Our study indicates that the PDPN-CLEC-2 interaction promotes experimental pulmonary metastasis in a mouse melanoma model. Tumour cell-induced platelet aggregation mediated by the interaction between PDPN and CLEC-2 is a key factor in melanoma pulmonary metastasis.


Assuntos
Neoplasias Pulmonares , Melanoma , Animais , Camundongos , Plaquetas/metabolismo , Lectinas Tipo C/metabolismo , Neoplasias Pulmonares/metabolismo , Melanoma/metabolismo , Glicoproteínas de Membrana/genética , Glicoproteínas de Membrana/metabolismo , Camundongos Endogâmicos C57BL , Agregação Plaquetária
15.
Elife ; 132024 Apr 04.
Artigo em Inglês | MEDLINE | ID: mdl-38573820

RESUMO

Thrombocytopenia caused by long-term radiotherapy and chemotherapy exists in cancer treatment. Previous research demonstrates that 5-Hydroxtrayptamine (5-HT) and its receptors induce the formation of megakaryocytes (MKs) and platelets. However, the relationships between 5-HT1A receptor (5-HTR1A) and MKs is unclear so far. We screened and investigated the mechanism of vilazodone as a 5-HTR1A partial agonist in promoting MK differentiation and evaluated its therapeutic effect in thrombocytopenia. We employed a drug screening model based on machine learning (ML) to screen the megakaryocytopoiesis activity of Vilazodone (VLZ). The effects of VLZ on megakaryocytopoiesis were verified in HEL and Meg-01 cells. Tg (itga2b: eGFP) zebrafish was performed to analyze the alterations in thrombopoiesis. Moreover, we established a thrombocytopenia mice model to investigate how VLZ administration accelerates platelet recovery and function. We carried out network pharmacology, Western blot, and immunofluorescence to demonstrate the potential targets and pathway of VLZ. VLZ has been predicted to have a potential biological action. Meanwhile, VLZ administration promotes MK differentiation and thrombopoiesis in cells and zebrafish models. Progressive experiments showed that VLZ has a potential therapeutic effect on radiation-induced thrombocytopenia in vivo. The network pharmacology and associated mechanism study indicated that SRC and MAPK signaling are both involved in the processes of megakaryopoiesis facilitated by VLZ. Furthermore, the expression of 5-HTR1A during megakaryocyte differentiation is closely related to the activation of SRC and MAPK. Our findings demonstrated that the expression of 5-HTR1A on MK, VLZ could bind to the 5-HTR1A receptor and further regulate the SRC/MAPK signaling pathway to facilitate megakaryocyte differentiation and platelet production, which provides new insights into the alternative therapeutic options for thrombocytopenia.


Assuntos
Trombocitopenia , Cloridrato de Vilazodona , Camundongos , Animais , Cloridrato de Vilazodona/efeitos adversos , Cloridrato de Vilazodona/metabolismo , Peixe-Zebra , Receptor 5-HT1A de Serotonina/metabolismo , Plaquetas/metabolismo , Trombocitopenia/tratamento farmacológico , Trombocitopenia/metabolismo , Megacariócitos/metabolismo , Trombopoese
16.
Methods Mol Biol ; 2774: 279-301, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-38441772

RESUMO

The in vitro differentiation of pluripotent stem cells into desired lineages enables mechanistic studies of cell transitions into more mature states that can provide insights into the design principles governing cell fate control. We are interested in reprogramming pluripotent stem cells with synthetic gene circuits to drive mouse embryonic stem cells (mESCs) down the hematopoietic lineage for the production of megakaryocytes, the progenitor cells for platelets. Here, we describe the methodology for growing and differentiating mESCs, in addition to inserting a transgene to observe its expression throughout differentiation. This entails four key methods: (1) growing and preparing mouse embryonic fibroblasts for supporting mESC growth and expansion, (2) growing and preparing OP9 feeder cells to support the differentiation of mESCs, (3) the differentiation of mESCs into megakaryocytes, and (4) utilizing an integrase-mediated docking site to insert transgenes for their stable integration and expression throughout differentiation. Altogether, this approach demonstrates a streamline differentiation protocol that emphasizes the reprogramming potential of mESCs that can be used for future mechanistic and therapeutic studies of controlling cell fate outcomes.


Assuntos
Megacariócitos , Células-Tronco Embrionárias Murinas , Animais , Camundongos , Fibroblastos , Plaquetas , Diferenciação Celular/genética
17.
Sci Rep ; 14(1): 6118, 2024 03 13.
Artigo em Inglês | MEDLINE | ID: mdl-38480828

RESUMO

Nonalcoholic fatty liver disease (NAFLD) is the most common chronic liver disease characterized by subclinical inflammation and is related to obesity and metabolic syndrome (MS), but it is also frequently observed in nonobese populations. We aimed to evaluate the relationship between the white blood cell count-to-mean platelet volume ratio (WBC/MPV), platelet-to-lymphocyte count ratio (PLR) and lymphocyte-monocyte ratio (LMR) in association with NAFLD, considering the presence of obesity and MS. Additionally, we aimed to investigate whether these parameters exhibited similar correlations in metabolic dysfunction-associated steatotic liver disease (MASLD) as observed in NAFLD. This cross-sectional study included subjects who underwent a comprehensive health evaluation, including blood tests and abdominal ultrasonography. Subgroup analyses were conducted based on obesity and MS. Out of a total 5929 subjects (3271 males, mean age 49.7 ± 10.6 years), 2253 (38.0%) had NAFLD. WBC/MPV was significantly higher, and PLR was significantly lower in subjects with NAFLD. In the analysis restricted to the nonobese (BMI < 25 kg/m2) population without MS, both WBC/MPV and PLR were independently associated with NAFLD: WBC/MPV (adjusted OR 3.366; 95% CI 2.238-5.066) and PLR (adjusted OR 0.997; 95% CI 0.996-0.999). When assessing the risk of NAFLD based on the WBC/MPV and PLR quartiles, the adjusted OR and 95% CI for the lowest quartile compared to the highest were 2.055 (95% CI 1.626-2.602) for WBC/MPV and 0.660 (95% CI 0.523-0.832) for PLR in the nonobese, metabolically healthy group. The levels of WBC/MPV and PLR were independently associated with NAFLD. Furthermore, in MASLD, an association with WBC/MPV, PLR and LMR was identified, similar to the results observed in NAFLD, even after adjusting for confounding variables. In conclusion, the present study demonstrated a significant association between NAFLD and platelet-related parameters, especially in nonobese, metabolically healthy subjects.


Assuntos
Síndrome Metabólica , Hepatopatia Gordurosa não Alcoólica , Masculino , Humanos , Adulto , Pessoa de Meia-Idade , Estudos Transversais , Plaquetas , Volume Plaquetário Médio , Obesidade
18.
Biol Pharm Bull ; 47(3): 652-659, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-38508745

RESUMO

Platelets have been reported to exert diverse actions besides hemostasis and thrombus formation in the body. However, whether platelets affect transporter activity remains to be determined. In this study, we examined the effects of platelets on the activity of amino acid transporter system A, which is known to be changed by various factors, and we clarified the mechanism by which platelets affect system A activity. Among system A subtypes, we found that sodium-coupled neutral amino acid transporter (SNAT) 4 played a central role in the transport activity of system A in HuH-7 human hepatoma cells. Interestingly, platelets showed a biphasic effect on system A activity: activated platelet supernatants (APS) including the granule contents released from platelets downregulated system A activity at lower concentrations and the downregulation was suppressed at higher concentrations. The downregulation was due to a decrease in the affinity of SNAT4 for its substrate and not a decrease in the SNAT4 abundance on the plasma membrane. In addition, APS did not decrease the expression level of SNAT4 mRNA. On the other hand, platelets did not affect system A activity when the platelet suspension was added to HuH-7 cells. These results indicate that platelets indirectly affect the transport activity of system A by releasing bioactive substances but do not directly affect it by binding to HuH-7 cells.


Assuntos
Carcinoma Hepatocelular , Neoplasias Hepáticas , Humanos , Sistemas de Transporte de Aminoácidos/metabolismo , Plaquetas/metabolismo , Membrana Celular/metabolismo , RNA Mensageiro/genética
19.
J Pediatr Hematol Oncol ; 46(3): 138-142, 2024 Apr 01.
Artigo em Inglês | MEDLINE | ID: mdl-38447120

RESUMO

The lack of a consensus of accepted prognostic factors in hypothermia suggests an additional factor has been overlooked. Delayed rewarming thrombocytopenia (DRT) is a novel candidate for such a role. At body temperature, platelets undergoing a first stage of aggregation are capable of progression to a second irreversible stage of aggregation. However, we have shown that the second stage of aggregation does not occur below 32°C and that this causes the first stage to become augmented (first-stage platelet hyperaggregation). In aggregometer studies performed below 32°C, the use of quantities of ADP that cause a marked first-stage hyperaggregation can cause an augmented second-stage activation of the platelets during rewarming (second-stage platelet hyperaggregation). In vivo, after 24 hours of hypothermia, platelets on rewarming seem to undergo second-stage hyperaggregation, from ADP released from erythrocytes, leading to life-threatening thrombocytopenia. This hyperaggregation is avoidable if heparin is given before the hypothermia or if aspirin, alcohol or platelet transfusion is given during the hypothermia before reaching 32°C on rewarming. Many of the open questions existing in this field are explained by DRT. Prevention and treatment of DRT could be of significant value in preventing rewarming deaths and some cases of rescue collapse. Performing platelet counts during rewarming will demonstrate potentially fatal thrombocytopenia and enable treatment with platelet infusions aspirin or alcohol.


Assuntos
Hipotermia , Trombocitopenia , Humanos , Reaquecimento , Hipotermia/etiologia , Hipotermia/terapia , Trombocitopenia/etiologia , Trombocitopenia/terapia , Plaquetas , Aspirina
20.
Immun Inflamm Dis ; 12(3): e1210, 2024 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-38506423

RESUMO

OBJECTIVE: This systematic review and meta-analysis aimed to evaluate the diagnostic value of the neutrophil-to-lymphocyte ratio (NLR) and platelet-to-lymphocyte ratio (PLR) in women with a history of abortion (missed and threatened) and recurrent pregnancy loss (RPL) in comparison with healthy pregnancies. METHODS: Electronic databases including MEDLINE, Scopus, Web of Science, Embase, and Cochrane Library were searched for NLR and PLR in women who experienced early pregnancy loss up to January 1, 2023 with a combination of proper keywords. Meta-analysis was done for comparison with three or more studies and summary estimates were measured. RESULTS: A total of 390 citations were retrieved initially, and after screening, 16 articles were deemed eligible for the final review. Among these, 14 studies underwent meta-analysis. The meta-analysis revealed that the standard mean of the NLR was significantly higher in abortion cases compared to the control group. However, there was no significant difference in the PLR between the pregnancy loss group and the control group. CONCLUSION: NLR was significantly higher among RPL patients compared to the control group, according to these data, NLR may be capable of being used in the diagnosis of RPL as an easy, cheap, and accessible modality. Further studies, which take these variables into account, will need to be undertaken to determine the diagnostic value of NLR and PLR in early pregnancy loss.


Assuntos
Aborto Habitual , Neutrófilos , Gravidez , Humanos , Feminino , Plaquetas , Linfócitos , Aborto Habitual/diagnóstico , Bases de Dados Factuais
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...