ATP5H/KCTD2 locus is associated with Alzheimer's disease risk.

To identify loci associated with Alzheimer disease, we conducted a three-stage analysis using existing genome-wide association studies (GWAS) and genotyping in a new sample. In Stage I, all suggestive single-nucleotide polymorphisms (at P<0.001) in a previously reported GWAS of seven independent studies (8082 Alzheimer's disease (AD) cases; 12 040 controls) were selected, and in Stage II these were examined in an in silico analysis within the Cohorts for Heart and Aging Research in Genomic Epidemiology consortium GWAS (1367 cases and 12904 controls). Six novel signals reaching P<5 × 10(-6) were genotyped in an independent Stage III sample (the Fundació ACE data set) of 2200 sporadic AD patients and 2301 controls. We identified a novel association with AD in the adenosine triphosphate (ATP) synthase, H+ transporting, mitochondrial F0 (ATP5H)/Potassium channel tetramerization domain-containing protein 2 (KCTD2) locus, which reached genome-wide significance in the combined discovery and genotyping sample (rs11870474, odds ratio (OR)=1.58, P=2.6 × 10(-7) in discovery and OR=1.43, P=0.004 in Fundació ACE data set; combined OR=1.53, P=4.7 × 10(-9)). This ATP5H/KCTD2 locus has an important function in mitochondrial energy production and neuronal hyperpolarization during cellular stress conditions, such as hypoxia or glucose deprivation.

Diagnostic validity of the Alzheimer's disease functional assessment and change scale in mild cognitive impairment and mild to moderate Alzheimer's disease.

BACKGROUND: The Alzheimer's Disease Functional Assessment and Change Scale (ADFACS) is a functional assessment instrument widely used in clinical research. AIMS: To test the diagnostic and concurrent validity of the Spanish version of this scale and to describe the functional deficit pattern for mild cognitive impairment (MCI) and Alzheimer's disease (AD) dementia. METHODS: The ADFACS, the Interview for Deterioration in Daily Living Activities in Dementia (IDDD), and the Mini Mental State Examination (MMSE) were administered to 146 control subjects (CS) and 165 patients (67 MCI and 98 AD). Nonparametric tests were used to compare the diagnostic groups. Cronbach's α and correlations with the MMSE and the IDDD were calculated. Sensitivity, specificity and predictive values were studied. RESULTS: The ADFACS had a high internal consistency (α = 0.95). Three cutoff points of 1, 4, and 17 were provided to separate CS and MCI patients, MCI and mild AD patients, and mild AD and moderate AD patients, respectively. The ADFACS strongly correlated with functional (IDDD, 0.927) and cognitive (MMSE, 0.747) measures. A similar pattern of dysfunction, but in different grades, was found for the MCI and AD groups. CONCLUSION: The ADFACS is a reliable, valid, and sensitive instrument to assess functional abilities; it is useful in dementia assessment for elderly populations.

Recognition of iodixanol by dendritic cells increases the cellular response in delayed allergic reactions to contrast media.

BACKGROUND: Delayed reactions to iodine contrast media (CM) account for 1-3% of patients with adverse reactions to iodine CM. The cellular and molecular mechanisms of these reactions remain poorly documented. Although most of these reactions are T cell mediated, the involvement of dendritic cells (DC) has not been investigated sufficiently. OBJECTIVE: To determine whether the T cell response to iodixanol requires DC as antigen-presenting cell and, more particularly, to evaluate the changes induced by iodixanol on DC maturation and in vitro production of cytokines after drug stimulation in patients with maculopapular exanthema. METHODS: Peripheral blood lymphocytes, immature monocyte-derived DC (imDC) and skin biopsies were obtained from patients with delayed reactions to iodixanol and tolerant subjects. We studied the consequences of the interaction between DC, lymphocytes and iodixanol by phenotype analysis, proliferation and cytokine production. RESULTS: A T-cell-mediated reaction was evidenced in patient biopsies, with a lymphocyte-rich, peri-vascular infiltrate. Iodixanol induced maturation of imDC from patients but not from controls, with expression of the co-stimulatory markers CD83, CD86 and CD40 and an increase in mean fluorescence intensity of CD80, CD86 and HLA-DR. In the absence of DC, positive cell proliferation to iodixanol was detected in only one patient while the addition of DC produced a positive test in five of the six patients. Similarly, the increase in cytokines (IFN-γ, IL-2, IL-6, IL-1b and TNF-α) was higher when imDC were introduced into the culture together with the culprit drug. CONCLUSION AND CLINICAL RELEVANCE: These results provide evidence for a DC-mediated mechanism in delayed allergic reactions to CM, influencing T cell proliferation and cytokine production. These new insights will be helpful for designing immunotherapeutic strategies and in vitro diagnostic tests of CM-delayed reactions.

Role of effector cells (CCR7(-)CD27(-)) and effector-memory cells (CCR7(-)CD27(+)) in drug-induced maculopapular exanthema.

Maculopapular exanthema (MPE) induced by drugs is a T-cell mediated reaction and effector cells may play an important role in its development. We assessed the effector and cutaneous homing phenotype in peripheral blood cells from allergic patients after drug stimulation. This study included 10 patients and 10 controls. The effector phenotype (CCR7(-)CD27(+/-)), chemokine receptors (CCR4 and CCR10), and activation (CD25(low)) and regulatory markers (CD25(high)) were measured by flow cytometry in both peripheral blood mononuclear cells (PBMCs) and CD4-T-lymphocytes. Proliferation was determined by 5-(-6)-carboxyfluorescein diacetate succinimidyl ester (CFSE) assay and the migratory capacity by a chemotaxis assay using CCL17 and CCL27. Compared to controls, CCR7(-)CD27(-) cells were increased in patients without (p=0.003) and with drug stimulation (p less than 0.001) and had significantly higher proliferation (p=0.010). CCR10 expression was increased in patients after drug stimulation in total and memory CD27(+) T-cells. Lymphocyte migration with CCL27 was higher in patients with drug stimulation (p=0.048), with a decrease in CCR7(-)CD27(-) (p less than 0.0001) and an increase in CCR7(-)CD27(+) (p=0.017). In patients, CD4-T-lymphocytes were significantly activated after drug stimulation (p less than 0.001). In conclusion, we show that effector memory CD4(+) T-cells (CCR7(-)CD27(+)) respond specifically to the drug responsible for MPE and confirm previous data about the involvement of CCR10 in cell trafficking to the skin.

Virulence of Metarhizium brunneum (Ascomycota: Hypocreales) Strains Against Stinkbugs Euschistus heros and Dichelops furcatus (Hemiptera: Pentatomidae).

Three strains of fungi belonging to the genus Metarhizium Sorokin (ARSEF 4556, ARSEF 3297, native strain) were assayed against adults and nymphs of the Neotropical brown stinkbug Euschistus heros (F.) and the green-belly stinkbug Dichelops furcatus (F.). The most virulent strain, ARSEF 4556, caused over 90% mortality. The average survival time of the second and fifth instar nymphs and adults following immersion in 1 × 108 conidia ml-1 was 4.8, 5.7, and 5.2 d, respectively. The second instar nymphs were more susceptible than the adults. The LC50 values and median survival times for second instar and adult E. heros were 1.6 × 107 and 3.1 × 107 conidia ml-1 and 6 and 8 d, respectively. Eggs of E. heros and the closely related stinkbug, D. furcatus, were highly susceptible to ARSEF 4556 with the mean mortality of eggs immersed in 1 × 108 conidia ml-1 being 77.4% and 89.7%, respectively. The strain 3297 showed also good aptitudes for stinkbugs control with mortalities higher than 80% against nymphs and adults and eggs mortalities of 75.5% for E. heros and 79.6% for D. furcatus. This study has shown that it is possible to have a two-pronged control strategy, targeting adults and to reduce oviposition and targeting egg clusters to prevent emergence and dispersal of nymphs. Besides early instars of nymphs have been shown to be more susceptible to the fungal strains than late instars and adults.

Whole-genome conditional two-locus analysis identifies novel candidate genes for late-onset Parkinson's disease.

Whole-genome epistasis analysis may add a new layer of knowledge to whole-genome association studies, permitting the identification of new candidate genes which are completely transparent during conventional single-locus analysis. We present the first whole-genome conditional two-locus analysis in Parkinson's disease (PD). We scanned the entire genome and selected markers that interacted with a set of well-known loci previously associated to PD (SNCA, Parkin, LRRK2, UCHL1, DJ-1, PINK and MAPT). Our work describes several loci potentially related to PD risk which interact with SNCA, PARK1 and LRRK2 markers. We propose conditional whole-genome two-locus association analysis as a valuable method that might be helpful in re-analysing and re-interpreting data from whole-genome association studies.

Calcitonin gene-related peptide modulates interleukin-13 in circulating cutaneous lymphocyte-associated antigen-positive T cells in patients with atopic dermatitis.

BACKGROUND: Neuropeptides (NPs) may play an important role in the pathogenesis of atopic dermatitis (AD) by regulating immune responses and contributing to the cross-talk between the immune and nervous systems. OBJECTIVES: To assess the ability of NPs to influence interleukin (IL)-13 and interferon (IFN)-gamma production and the expression of the activation marker HLA-DR in skin memory T cells [cutaneous lymphocyte-associated antigen (CLA)+ T cells] from patients with AD with severe, chronic lesions and intense pruritus, and from nonatopic controls. METHODS: Cells were cultured in the presence and absence of different NPs, calcitonin gene-related peptide (CGRP), somatostatin (SOM) and substance P (SP). IL-13 and IFN-gamma production and HLA-DR expression were measured in both CLA+ and CLA- T-cell subsets by flow cytometry. RESULTS: CGRP increased IL-13 production in peripheral blood mononuclear cells from patients with AD (P < 0.05), with no changes detected in the presence of SOM or SP. These patients with AD had a lower expression of CGRP receptor compared with controls (P < 0.05). Memory T cells incubated with CGRP also showed an increase in IL-13 (P < 0.05) and HLA-DR (P < 0.05) in CLA+ T cells from patients with AD compared with controls, but not in CLA- T cells. Patients with a higher production of IL-13 were those with higher total IgE and percentage of skin area involved. Furthermore, the IL-13/IFN-gamma ratio was increased in patients with AD after cells were cultured with CGRP (P < 0.05). CONCLUSIONS: Our results suggest an immunomodulatory role of CGRP towards a Th2 pattern in CLA+ T cells, which may contribute to exacerbating clinical symptoms in patients with AD.

Lymphocyte proliferation response in patients with delayed hypersensitivity reactions to heparins.

BACKGROUND: Heparins can induce delayed-type hypersensitivity (DTH) reactions mediated by specific T lymphocytes. However, the interaction between heparins and lymphocytes has not been sufficiently studied. OBJECTIVES: To analyse the lymphocyte response to heparins using different types of antigen-presenting cells in patients with DTH reactions to these drugs. METHODS: We studied seven patients with DTH reactions to heparins diagnosed by delayed reading of intradermal skin testing (n = 5) or drug provocation test (n = 2) and nine tolerant controls. Biopsies were obtained from intradermal testing or during the acute reaction. Peripheral blood mononuclear cells were used to obtain T and B lymphocytes, monocytes and monocyte-derived dendritic cells (DC). T-lymphocyte proliferation was assayed by means of (3)H-thymidine incorporation. RESULTS: Skin testing showed a high degree of cross-reactivity within low molecular weight heparins with good tolerance to sodium heparin, fondaparinux and lepirudin in most cases. The proliferative response was positive in six patients to most of the heparins tested with both monocytes and B cells (the classical lymphocyte transformation test) or immature DC as antigen-presenting cells, giving a higher response with DC. At a second evaluation 1 year later, the proliferative response was found only with DC, and mainly to the culprit drug. CONCLUSIONS: A model using DC in the lymphocyte proliferation test is a more appropriate way to assess the immunological response in DTH to heparins; additionally, it can detect a response over a longer time. These findings may be useful for the diagnostic evaluation of drug reactions.

Prevalence of dementia and cognitive impairment in Southeastern Spain: the Ariadna study.

OBJECTIVES: To estimate the prevalence of amnestic mild cognitive impairment (aMCI), cognitive impairment, no dementia (CIND) and dementia in a general elderly population and to examine the associated socio-demographic factors. METHODS: The Ariadna study is a population-based cross-sectional study of cognitive function involving 1074 individuals aged 65-96 years from the Murcia Region of southeastern Spain. Prevalence, adjusted odds ratio (OR) and 95% confidence intervals (CI) were calculated. RESULTS: The overall prevalence was 8.7% (95% CI 7.1-10.5) for aMCI, 14.5% (95% CI 12.4-16.8) for CIND and 5.5% (95% CI 4.3-7.1) for dementia. Dementia was associated with age (OR 1.13 95% CI 1.09-1.18 for a 1-year increase in age). Illiterate subjects were more likely to present aMCI (OR 2.59; 95% CI 1.09-6.14) and dementia (OR 4.09; 95% CI 1.28-13.08) than subjects with secondary or higher education. Rural area residents (OR 2.13, 95% CI 1.07-4.24) and women (OR 1.53, 95% CI 1.06-2.22) were more likely to have CIND. CONCLUSION: The prevalence of dementia was low, despite a high prevalence of aMCI and CIND. Dementia was strongly associated with age and education. CIND was associated with living in a rural area and with female sex, while aMCI was associated with illiteracy.

GAB2 gene does not modify the risk of Alzheimer's disease in Spanish APOE 4 carriers.

OBJECTIVES: The genetic basis of Alzheimer's disease (AD) is being analyzed in multiple whole genome association studies (WGAS). The GAB2 gene has been proposed as a modifying factor of APOE epsilon 4 allele in a recent case-control WGAS conducted in the US. Given the potential application of these novel results in AD diagnostics, we decided to make an independent replication to examine the GAB2 gene effect in our series. DESIGN: We are conducting a multicenter population-based study of AD in Spain. PARTICIPANTS: We analyzed a total of 1116 Spanish individuals. Specifically, 521 AD patients, 475 controls from the general population and 120 neurologically-normal elderly controls (NNE controls). METHODS: We have genotyped GAB2 (rs2373115 G/T) and APOE rs429358 (SNP112)/rs7412 (SNP158) polymorphisms using real time-PCR technologies. RESULTS: As previously reported in Spain, APOE epsilon 4 allele was strongly associated with AD in our series (OR=2.88 [95% C.I. 2.16- 3.84], p=7.38E-11). Moreover, a large effect for epsilone 4/epsilone 4 genotype was also observed (OR=14.45 [95% C.I., 3.34-125.2], p=1.8E-6). No difference between the general population and the NNE controls series were observed for APOE genotypes (P > 0.61). Next, we explored GAB2 rs2373115 SNP singlelocus association using different genetic models and comparing AD versus controls or NNE controls. No evidence of association with AD was observed for this GAB2 marker (p > 0.17). To evaluate GAB2-APOE genegene interactions, we stratified our series according to APOE genotype and case-control status, in accordance with the original studies. Again, no evidence of genetic association with AD was observed in any strata of GAB2-APOE loci pair (p > 0.34). CONCLUSION: GAB2 rs2373115 marker does not modify the risk of Alzheimer's disease in Spanish APOE epsilon 4 carriers.

Non-immediate reactions to beta-lactams: diagnostic value of skin testing and drug provocation test.

BACKGROUND: beta-Lactam (BL) antibiotics can induce non-immediate skin reactions, frequently manifested as exanthema or urticaria. The time between drug intake and the reaction appearance is generally 24-48 h. Because the mechanisms involved are not completely understood, diagnostic tests for these reactions have still to be fully validated. OBJECTIVE: To evaluate the role of skin and drug provocation tests (DPTs) in the diagnosis of patients with non-immediate reactions to BL. METHODS: We evaluated a group of 22 patients who developed maculopapular exanthema or urticarial exanthema after BL intake. Diagnosis was confirmed by DPT with BL. Intradermal/patch testing was performed with benzylpenicilloyl, minor determinant mixture, amoxicillin (AX), ampicillin (AMP) and the culprit drug in patients and in 22 negative controls. Immunohistochemical studies were done in the affected skin at the acute phase of the reaction and after a delayed positive skin test/DPT. IFN-gamma and IL-4 were quantified in peripheral mononuclear cells, obtained during the positive response to DPT and after resolution of the symptoms. RESULTS: From the total number of cases, 12 patients developed urticarial exanthema and 10 maculopapular exanthema after DPT. Only two of the 22 patients (9%) had a positive delayed intradermal skin test: one to AX/AMP and the other to cloxacillin. Biopsies showed a mononuclear CD4, CD8 infiltrate and activated and memory cells. The cytokine expression showed a Th1 pattern in patients, in contrast with the Th0 pattern in controls. CONCLUSION: In patients with non-immediate reactions to BLs (maculopapular exathema or urticarial exanthema), the sensitivity of skin testing is low and DPT may be required to establish the diagnosis. The reproducibility of the reactions and the cytokine pattern expressed during the acute episode support a T cell-induced non-immediate response.

Magnetic resonance spectroscopy performance for detection of dementia, Alzheimer's disease and mild cognitive impairment in a community-based survey.

BACKGROUND/AIMS: To evaluate (1)H-labelled magnetic resonance spectroscopy (MRS) in patients with a low Mini Mental State Examination (MMSE) score identified during a dementia community-based survey. METHODS: A population sample of 1,500 individuals (>64 years old) was randomly selected. Two hundred and fifteen individuals (MMSE < or =24) were sorted into clinical groups: dementia, Alzheimer's disease, mild cognitive impairment (MCI), normal. Up to 56 of these individuals attended the MRS appointment. Two single-voxel sequences (TR 1,500, TE 35/144 ms) were carried out in the posterior cingulate gyrus of each individual, and the ratios N-acetylaspartate (NAA)/creatine (Cr), choline (Cho)/Cr, myo-inositol (mI)/Cr, NAA/mI and NAA/Cho were compared statistically. The ability of MRS to distinguish clinical groups was assessed by receiver-operating characteristics analysis. Cognition effects on metabolite ratios were estimated, with gender and cognition as categorical variables and age as a continuous covariate. RESULTS: NAA/Cr and NAA/Cho ratios were lower in dementia or Alzheimer's disease than in MCI and normal groups. The NAA/Cr ratio at TE 35 ms performed best when distinguishing dementia or Alzheimer's disease from non-demented subjects (cut-off point 1.40). MRS could not distinguish between MCI patients and normal subjects. Dementia was an independent predictor of metabolite values. CONCLUSION: In a population sample, conventional MRS still proved to be a useful tool for dementia discrimination, but it is potentially far less useful as a surrogate marker for MCI.

Perceived quality in a dementia unit: patients' caregivers as information providers. / Calidad percibida en una unidad de demencias: el portavoz del paciente como proveedor de información.

INTRODUCTION: Dementia units (DU) provide comprehensive and specialised care to patients with dementia. However, assessment in these units normally focuses on patient management. The aim of this study was to determine satisfaction of the caregivers of patients managed in a DU and how they rated DU care. METHODS: We created a self-administered questionnaire which was completed by 236 caregivers visiting the DU in 2015. The questionnaire included 6 dimensions (accessibility, organisation, professionalism, relationship with staff, information, and facilities); data were analysed using problem rates. RESULTS: A total of 53.4% caregivers completed the questionnaire; most were women, patients' spouses, or first-degree relatives. The overall problem rates was 15.0% (95% CI, 13.9-16.1), with sizeable differences between dimensions: from 0.1% (95% CI, 0.0-0.4) for 'relationship with staff' and 'professionalism' to 49.3% (95% CI, 45.4-53.2) for 'information'. Waiting times over 30minutes were perceived as excessive. Information problems were not directly related to patient management. Satisfaction was scored 8.29/10 (median 8; SD 1.45); 77.3% (95% CI, 69.8-74.8) of respondents were highly satisfied. Ninety-nine percent of the caregivers stated that they would recommend the DU. CONCLUSIONS: This questionnaire provides interesting data on care quality as perceived by patients' caregivers. Our results have allowed us to identify problems and implement corrective actions. Our questionnaire has proved to be a useful tool for evaluating and improving care quality in DUs.

T cell assessment in allergic drug reactions during the acute phase according to the time of occurrence.

Allergic drug reactions can be classified as immediate, accelerated or delayed. This classification usually correlates with the mechanism involved: immediate reactions are IgE mediated and delayed reactions are T cell dependent. We analyzed lymphocyte involvement in patients with these reactions by determining cell subpopulations, activation state and skin homing receptor expression (CLA) in blood and skin. Patients with immediate, accelerated and delayed reactions were evaluated during the acute phase and after resolution. Controls taking drugs were included. Phenotypic immunofluorescence analysis was done by flow cytometry in peripheral blood, and by immunohistochemistry in skin for delayed reactions. Forty-six patients were included, 17 with immediate reactions, 10 accelerated and 19 delayed. At the acute phase CLA was significantly increased in delayed reactions and HLA-DR in all three types of reaction. In the severest delayed reactions, Steven-Johnson/Lyell syndromes, the CD4 subsets were increased in peripheral blood and skin compared to maculopapular exanthemas and urticaria and HLA-DR when compared with urticaria. In maculopapular exanthemas CLA was significantly increased in peripheral blood and skin compared to urticaria and the severe reactions. We found that T-cells are implicated, besides delayed reactions, in immediate and accelerated reactions. In delayed reactions there is a parallelism between results found in skin and peripheral blood with a higher participation of CD4+ cells the more severe the reaction.

A New Tomato yellow leaf curl virus Strain in Southern Spain.

Tomato yellow leaf curl disease (TYLCD) has affected tomato crops annually in southern Spain since 1992 when Tomato yellow leaf curl Sardinia virus (TYLCSV-ES) was first described. In 1997, the presence of a different begomovirus species (TYLCV-[ES7297]) was reported in common bean (Phaseolus vulgaris). In 1999, TYLCV-[ES7297] was found in pepper (Capsicum annuum) (2). In September 2002, we observed tomato plants of TYLCD tolerant tomato cultivars (Kampala and Tiway) showing strong TYLCD symptoms (shortened internodes, curling of leaflet margins, and leaf blade reduction). Samples from 90 of these plants were collected from greenhouses located in the Province of Murcia and analyzed by Southern blot using the intergenic region of TYLCSV-ES[2] and TYLCV-[ES7297] as specific probes. Positive signals were obtained for TYLCV-[ES7297] and TYLCSV-ES[2] in 88 and 23 of the plants, respectively. Samples from eight TYLCV single-infected plants (four 'Kampala' and four 'Tiway') were analyzed by polymerase chain reaction using a pair of primers (OTYA7: GCTCCCTGAATGTTCGGATGGA and OTYA8: ATCATGGATTT ACGCACAGGGG) designed to amplify a 1.9-kb fragment of any isolate of TYLCV/TYLCSV. Subsequent restriction fragment length polymorphism analysis of the amplification products yielded a restriction pattern different from that obtained for TYLCV-[ES7297]. Fragments from the eight samples were sequenced and showed 97.9% identity to a TYLCV strain previously reported in Israel (X15656) (1) and only 92.7% identify with TYLCV-[ES7297]. To our knowledge, this is the first report that this strain of TYLCV has been detected in Spain. References: (1) N. Navot et al. Virology 185(1), 151, 1991. (2) J. Reina et al. Plant Dis. 83:1176, 1999.

Follow-up of loci from the International Genomics of Alzheimer's Disease Project identifies TRIP4 as a novel susceptibility gene.

To follow-up loci discovered by the International Genomics of Alzheimer's Disease Project, we attempted independent replication of 19 single nucleotide polymorphisms (SNPs) in a large Spanish sample (Fundació ACE data set; 1808 patients and 2564 controls). Our results corroborate association with four SNPs located in the genes INPP5D, MEF2C, ZCWPW1 and FERMT2, respectively. Of these, ZCWPW1 was the only SNP to withstand correction for multiple testing (P=0.000655). Furthermore, we identify TRIP4 (rs74615166) as a novel genome-wide significant locus for Alzheimer's disease risk (odds ratio=1.31; confidence interval 95% (1.19-1.44); P=9.74 × 10(-)(9)).

Calidad percibida en una unidad de demencias: el portavoz del paciente como proveedor de información / Perceived quality in a dementia unit: patients' caregivers as information providers

INTRODUCCIÓN: Las unidades de demencia (UD) realizan un abordaje integral y especializado de las personas con demencia. Su evaluación suele limitarse a aspectos asistenciales. El objetivo del trabajo fue conocer la satisfacción y calidad percibida por familiares/cuidadores de pacientes atendidos por una UD. MÉTODOS: Encuesta autocumplimentada con cuestionario de elaboración propia a 236 acompañantes de pacientes ya conocidos en la UD durante 2015, estructurada en 6 dimensiones (accesibilidad, organización, profesionalidad, trato, información e infraestructura) y analizada mediante tasas de problemas. RESULTADOS: Tasa de respuesta de 53,4%, resultando la mayoría mujeres, cónyuges o familiares de primer grado de los pacientes. La tasa de problemas global fue 15,0% (IC 95%: 13,9-16,1), con amplias variaciones por dimensión: desde 0,1% (IC 95%: 0,0-0,4) en "trato" y "profesionalidad" hasta 49,3% IC 95%: 45,4-53,2) en «información». La espera se percibe excesiva a partir de 30min. Los problemas de información se centraron en actividades no directamente asistenciales. La satisfacción fue 8,29/10 (mediana 8; DE: 1,45) con 77,3% (IC 95%: 69,8-74,8) de puntuaciones excelentes. El 99% recomendarían la UD. CONCLUSIONES: El cuestionario ha ofrecido una visión global de la calidad percibida por los familiares/cuidadores de los pacientes atendidos, y permitido identificar y priorizar dónde implantar acciones correctoras. Ha demostrado ser una herramienta útil para evaluar y mejorar la calidad asistencial en las UD

INTRODUCTION: Dementia units (DU) provide comprehensive and specialised care to patients with dementia. However, assessment in these units normally focuses on patient management. The aim of this study was to determine satisfaction of the caregivers of patients managed in a DU and how they rated DU care. METHODS: We created a self-administered questionnaire which was completed by 236 caregivers visiting the DU in 2015. The questionnaire included 6 dimensions (accessibility, organisation, professionalism, relationship with staff, information, and facilities); data were analysed using problem rates. RESULTS: A total of 53.4% caregivers completed the questionnaire; most were women, patients' spouses, or first-degree relatives. The overall problem rates was 15.0% (95% CI, 13.9-16.1), with sizeable differences between dimensions: from 0.1% (95% CI, 0.0-0.4) for 'relationship with staff' and 'professionalism' to 49.3% (95% CI, 45.4-53.2) for 'information'. Waiting times over 30minutes were perceived as excessive. Information problems were not directly related to patient management. Satisfaction was scored 8.29/10 (median 8; SD 1.45); 77.3% (95% CI, 69.8-74.8) of respondents were highly satisfied. Ninety-nine percent of the caregivers stated that they would recommend the DU. CONCLUSIONS: This questionnaire provides interesting data on care quality as perceived by patients' caregivers. Our results have allowed us to identify problems and implement corrective actions. Our questionnaire has proved to be a useful tool for evaluating and improving care quality in DUs

Cost-effectiveness of therapeutic interventions in schizophrenia

Background: Various studies have reported that a decision-tree analysis is useful to evaluate different treatment strategies in real clinical practice. Objective: The main aim of this study was to research the clinical decisions regarding the treatment of patients who were diagnosed with schizophrenia. Method: Cost-effectiveness study of three different interventions to treat patients with schizophrenia were studied. Interventions were divided into the following categories: a) day hospital (psycho-educational treatment+psychiatric consultation+psychopharmacological treatment); b) therapy adherence clinic (psychopharmacological treatment with depot antipsychotic medication+psychiatric consultation); c) outpatient psychiatric care (psychopharmacological treatment+psychiatric consultation). For this purpose decision tree model was designed and three outcomes were measured (therapeutic compliance, non-compliance and rehospitalization). TreeAge software was used in order to estimate outcome probabilities and sensitivity analysis, distribution Beta for probabilities and Gamma for cost of interventions. Results: The probability of therapeutic compliance and average semestral cost of therapy adherence clinic, outpatient psychiatric care and day hospital are 0.594, 0.284, 2.393, and mean cost intervention US$ 2145.6, US$ 700.2 and US$ 1412.1 respectively (IC95%), according to Montecarlo analysis. Conclusions: According to the results, the clinical decision to treat patients in therapy adherence clinic improved therapeutic compliance, but the cost of treatment was higher. There were extra costs and risks to society and patient that are associated with therapeutic non-compliance. It is less expensive for the health care system to provide the patients outpatient psychiatric care, but perhaps in the long-term outpatient psychiatric care is more costly for the patient, their family, and society. According to the many important limitations of this study, further studies are needed to reject/confirm these strategies to be included in real clinical practice

No disponible

[Serological study carried out in Cuban localities where confirmed western Nile virus infection is present]. / Estudio serológico en localidades cubanas con infecciones confirmadas al virus del Nilo Occidental.

INTRODUCTION: first infected cases caused by West Nile virus were reported in Cuba in 2004. OBJECTIVE: to monitor and learn about the prevalence of the West Nile virus in those areas with confirmed cases. METHODS: the study was conducted in Jatibonico municipality and in the city of sancti Spiritus. A total number of 14 persons, 8 horses and 41 birds were researched to detect antibodies to flavivirus and specific antibodies to West Nile virus. RESULTS: the presence of specific antibodies to West Nile virus was confirmed in 4 samples of sera from birds and in 4 from horses. One person was confirmed as one case of asymptomatic West Nile virus infection. CONCLUSIONS: the presence of specific antibodies to West Nile virus in birds, horses and persons residing in areas where there are confirmed cases showed that a local amplification cycle had been established in Cuba before this study.

[Regional effects of age and sex in magnetic resonance spectroscopy]. / Efecto regional, de la edad y el sexo en la espectroscopia por resonancia magnética cerebral.

OBJECTIVE: To determine the regional effects of age and sex on the metabolic ratios obtained in the medial temporal lobe, the posteromedial region, and the frontal lobe at 1.5 T single-voxel magnetic resonance spectroscopy. MATERIAL AND METHODS: We used single-voxel magnetic resonance spectroscopy to study the areas of the brain most affected in neurodegenerative disease (the left frontal lobe, the left medial temporal lobe, and the posteromedial region) in 31 healthy subjects older than 55 years of age (group 1) and in 20 healthy subjects under 30 years of age (group 2). We calculated the following ratios for each voxel: N-acetyl-aspartate/creatine-phosphocreatine (NAA/Cr), N-acetyl-aspartate/choline (NAA/Cho), N-acetyl-aspartate /myoinositol (NAA/mI), choline/creatine-phosphocreatine (Cho/Cr), and myoinositol (mI/Cr). We compared the metabolic ratios in each region in each group and the correlation between age and the ratios within age ranges. Finally, we analyzed the differences in the metabolic ratios between groups and between sexes. RESULTS: In group 1, we found negative correlations between age and Cho/Cr in the frontal region and NAA/mI in the temporal region. In group 2, we found negative correlations between age and mI/Cr and NAA/Cho in the temporal region as well as a positive correlation between age and NAA/mI in the temporal region. In the frontal lobe and the posteromedial region, NAA/Cr, NAA/Cho, and NAA/mI were lower in group 1 (P≤0.003). No differences between groups were seen in Cho/Cr or mI/Cr. The values of the ratios differed regionally in all cases (P<0.001). In the temporal lobe, NAA/Cr and Cho/Cr were higher in women (P≤0.034). CONCLUSIONS: When using single-voxel magnetic resonance spectroscopy, especially in patients with neurodegenerative disease, variations due to region, age, and sex should always be taken into account.