RESUMEN
Particulate and denatured core protein as well as e-antigen (HBe) of hepatitis B virus (HBV) differ in part immunologically but this has not been studied in sufficient detail. Therefore, in this study the B-cell immune response to native and denatured HBV core protein which both can exhibit HBe-specific epitopes was examined using a panel of mouse MABs and rabbit polyclonal antibodies to native and denatured core protein and polyclonal anti-HBe/anti-HBc antibodies from sera of infected patients. Epitope mapping was performed using a set of partially overlapping synthetic HBc peptides, carboxy-terminally truncated HBc proteins and various HBc fusion proteins. A major immunogenic region between amino acids 134-140 and two less immunogenic regions, one spanning amino acids 2-10 and one with three partially overlapping epitopes between amino acid positions 138 and 154, were defined by mouse MABs. Polyclonal rabbit antibodies to denatured HBc, woodchuck and ground squirrel hepatitis core proteins (WHc and GSHc) recognized similar epitopes but in addition occasionally region 61-85, and the latter was also recognized on particulate HBc. Two antigenic regions (amino acid positions 2-10 and 138-145) were found to be exposed on HBe from human serum, and were recognized by mouse anti-HBe but not by anti-HBc antibodies from sera of infected patients. This study demonstrates a more complex pattern of HBc and HBe epitopes than detected previously and provides tools to study conformational changes which may take place during HBc/HBe processing, transport and core particle assembly.
Asunto(s)
Anticuerpos Monoclonales/inmunología , Epítopos/análisis , Antígenos del Núcleo de la Hepatitis B/inmunología , Antígenos e de la Hepatitis B/inmunología , Secuencia de Aminoácidos , Animales , Secuencia de Bases , Humanos , Ratones , Ratones Endogámicos BALB C , Datos de Secuencia Molecular , Conformación Proteica , Desnaturalización Proteica , ConejosRESUMEN
A plasmid carrying the complete genome of hepatitis B virus (HBV) inserted into the BamHI site of the pBR322 plasmid vector has been constructed. The physical map of HBV DNA established for 13 restriction endonucleases allows to conclude that the cloned DNA is similar, but not identical to the HBV DNA of ayw subtype.
Asunto(s)
ADN Viral/genética , Virus de la Hepatitis B/genética , Mapeo Cromosómico , Clonación Molecular , Enzimas de Restricción del ADN , Escherichia coli/genéticaRESUMEN
Direct expression of hepatitis B virus (HBV) surface antigen (HBsAg) gene under the control of the Escherichia coli tryptophan operon (trp) promoter has been achieved. Synthesis of HBsAg (both complete and lacking its N-terminal segment) as a part of hybrid proteins with the N-terminal portion coded by genes cat, kan or bla is controlled by the appropriate promoters, as well as by the trp promoter. The highest levels of expression, including those for direct synthesis of HBsAg, provide the accumulation of about 10(5) polypeptide molecules per bacterial cell.
Asunto(s)
Escherichia coli/genética , Genes Virales , Antígenos de Superficie de la Hepatitis B/genética , Clonación Molecular , Escherichia coli/crecimiento & desarrollo , Escherichia coli/inmunología , Regulación de la Expresión Génica , Antígenos de Superficie de la Hepatitis B/aislamiento & purificación , Operón , PlásmidosRESUMEN
The entire genome of human hepatitis B virus (HBV) occurring in Latvia was sequenced. This sequence, which is 3182 nucleotides long, was compared with the other previously published HBV genomes and was shown to share maximum homology with HBV subtype ayw DNA. The coordinates of 4 main open reading frames as well as hairpin structures are very well conserved in the two genomes. The distribution of nucleotide substitutions among different HBV genomes suggest that the open reading frames P and X can fulfil a coding function. On the basis of primary structure comparison for hepadnaviral DNAs several evolutionary conclusions can be drawn.
Asunto(s)
ADN Viral , Variación Genética , Virus de la Hepatitis B/genética , Secuencia de Aminoácidos , Secuencia de Bases , Evolución Biológica , Codón , Antígenos del Núcleo de la Hepatitis B , Antígenos de Superficie de la Hepatitis B , MutaciónRESUMEN
Three 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAACAUGAAGAAUACCCAUG (III), corresponding to the minimal initiation region for the replicase gene of phage MS2 and fr or having some differences were synthesized using enzymatic methods. The template activity of the synthesized polynucleotides in initiation and their capacity to bind phage coat protein were studied under conditions optimal for native mRNA. Polynucleotides I and II exhibit template activity comparable to that of the native phage RNA fragments. Polynucleotide III with the destroyed SD sequence dit not manifest any functional activity either as template or in binding to MS2 phage coat protein.
Asunto(s)
Genes , Iniciación de la Cadena Peptídica Traduccional , Polirribonucleótidos/metabolismo , ARN Nucleotidiltransferasas/genética , Fagos ARN/genética , ARN Polimerasa Dependiente del ARN/genética , Secuencia de Bases , Sitios de Unión , Hidrólisis , Polirribonucleótidos/genética , Fagos ARN/enzimología , Moldes GenéticosRESUMEN
Affinity labelling of E. coli ribosomes with the 2',3'-O-[4-(N-2-chloroethyl)-N-methylamino]benzylidene derivative of AUGU6 was studied within the initiation complex (complex I) obtained by using fMet-tRNAMetf and initiation factors and within the pretranslocational complex (complex II) obtained by treatment of complex I with the ternary complex Phe-tRNAPhe.GTP.EF-Tu. Both proteins and rRNA of 30 S as well as 50 S subunits were found to be labelled. Sets of proteins labelled within complexes I and II differ considerably. Within complex II, proteins S13 and L10 were labelled preferentially. On the other hand, within complex I, multiple modification is observed (proteins S4, S12, S13, S14, S15, S18, S19, S20/L26 were found to be alkylated) despite the single fixation of a template in the ribosome by interaction of the AUG codon with fMet-tRNAMetf.
Asunto(s)
Marcadores de Afinidad/metabolismo , Codón , Escherichia coli/genética , Iniciación de la Cadena Peptídica Traduccional , ARN Mensajero , Ribosomas/metabolismo , Sitios de Unión , Complejo II de Transporte de Electrones , Escherichia coli/metabolismo , Guanosina Trifosfato/metabolismo , Complejos Multienzimáticos/metabolismo , Compuestos de Mostaza , NAD(P)H Deshidrogenasa (Quinona) , Oxidorreductasas/metabolismo , Factor Tu de Elongación Peptídica/metabolismo , Quinona Reductasas/metabolismo , ARN Mensajero/metabolismo , Aminoacil-ARN de Transferencia/metabolismo , Proteínas Ribosómicas/metabolismo , Succinato Deshidrogenasa/metabolismoRESUMEN
Insertion of foreign oligopeptide sequences (40-50 amino acids in length) into the Pro144 position of hepatitis B core antigen (HBcAg) leads to the formation of chimeric capsids in Escherichia coli cells. These capsids are morphologically and immunologically similar to native HBcAg, but expose the inserted oligopeptides on their outer surface and exhibit antigenic and immunogenic characteristics of the latter. As a source of model antigenic determinants, the appropriate DNA copies excised from cloned viral genes such as the pre-S region of hepatitis B virus, the transmembrane protein gp41 of human immunodeficiency virus 1 and the envelope protein gp51 of bovine leukemia virus have been used. The localization of the inserted antigenic determinants on the surface of chimeric capsids does not depend on the presence or absence of the arginine-rich, 39 amino acid-long C terminus of HBcAg.
Asunto(s)
Antígenos Virales/genética , Antígenos de la Hepatitis B/genética , Antígenos del Núcleo de la Hepatitis B/inmunología , Cápside/inmunología , ADN Recombinante , Epítopos , Genes Virales , Vectores Genéticos , Proteína gp41 de Envoltorio del VIH/genética , Proteína gp41 de Envoltorio del VIH/inmunología , Antígenos del Núcleo de la Hepatitis B/genética , Virus de la Hepatitis B/genética , Virus de la Hepatitis B/inmunología , Virus de la Hepatitis B/ultraestructura , Inmunohistoquímica , Virus de la Leucemia Bovina/genética , Virus de la Leucemia Bovina/inmunología , Datos de Secuencia Molecular , Vacunas Sintéticas , Proteínas del Envoltorio Viral/genética , Proteínas del Envoltorio Viral/inmunologíaRESUMEN
The structural aspects of recognition by E. coli ribosomes of translational initiation regions on homologous messenger RNAs have been reviewed. Also discussed is the location of initiation region on mRNA, its confines, typical nucleotide sequences responsible for initiation signal, and the influence of RNA macrostructure on protein synthesis initiation. Most of the published DNA nucleotide sequences surrounding the start of various E. coli genes and those of its phages have been collected.
Asunto(s)
Escherichia coli/genética , Iniciación de la Cadena Peptídica Traduccional , ARN Mensajero/genética , Secuencia de Bases , Codón , Colifagos/genética , Escherichia coli/metabolismo , Genes Bacterianos , Genes Virales , Modelos Genéticos , Ribosomas/metabolismoRESUMEN
Five different hybridoma clones secreting anti-HBeAg antibody were constructed by fusing cells of mouse myeloma line SP2/0 with splenocytes from BALB/c mice immunized with recombinant HBeAg. The monoclonal antibodies obtained were characterized immunologically and one was used to develop ELISA for detection of HBeAg and anti-HBeAg antibody. These monoclonal assays enabled the detection of 3 U HBeAg/ml and 1 U anti-HBeAg/ml with reference to standards of the Paul Ehrlich Institute, Frankfurt, F.R.G. Both assays compared well with a commercially available kit (Abbott Laboratory) and were used for detection of HBeAg and anti-HBeAg antibody in clinical serum samples.
Asunto(s)
Anticuerpos Monoclonales/inmunología , Anticuerpos contra la Hepatitis B/análisis , Antígenos e de la Hepatitis B/inmunología , Virus de la Hepatitis B/inmunología , Hepatitis B/diagnóstico , Animales , Línea Celular , Antígenos de Superficie de la Hepatitis B/inmunología , Humanos , Hibridomas/inmunología , Ratones , Ratones Endogámicos BALB C , Proteínas Recombinantes/inmunologíaRESUMEN
Age-dependent decline of the anti-tumour efficacy of local IL-2 immunotherapy and chemoimmunotherapy utilizing human recombinant interleukin 2 and cyclophosphamide was investigated in B10 mice bearing syngeneic MC-induced sarcoma. Repeated peritumoral injections of rIL-2 substantially inhibited growth of transplantable MC-induced sarcomas in syngeneic young adult mice whereas no effect was observed in the aged mice. Chemoimmunotherapy of the MC-induced sarcomas in the young adult and in the aged mice treated with cyclophosphamide plus rIL-2 revealed that subthreshold doses of CY were capable of significantly potentiating the immunotherapeutic effect of rIL-2 in young adult mice but not in the aged mice.
Asunto(s)
Envejecimiento , Ciclofosfamida/uso terapéutico , Interleucina-2/uso terapéutico , Sarcoma Experimental/tratamiento farmacológico , Animales , Humanos , Inmunoterapia , Masculino , Metilcolantreno , Ratones , Ratones Endogámicos C57BL , Proteínas Recombinantes/uso terapéutico , Sarcoma Experimental/inducido químicamenteRESUMEN
Four different hybridoma clones secreting anti-HBcAg antibodies were constructed by fusing cells of the mouse myeloma line SP2/0 with lymphocytes from mice immunized with bacterially produced HBcAg. The monoclonal antibodies were immunologically characterized and used for HBcAg detection by ELISA. This monoclonal-antibody-based assay was compared with ELISA based on polyclonal human anti-HBcAg IgG for sensitivity and specificity. The monoclonal antibody reacted specifically both with the bacterially produced HBcAg and HBcAg isolated from human liver, but did not react with HBeAg. The human polyclonal antibody reacted with HBcAg, but also with HBeAg.
Asunto(s)
Anticuerpos Monoclonales , Antígenos del Núcleo de la Hepatitis B/inmunología , Proteínas Recombinantes/inmunología , Animales , Anticuerpos , Ensayo de Inmunoadsorción Enzimática , Antígenos del Núcleo de la Hepatitis B/análisis , Antígenos del Núcleo de la Hepatitis B/genética , Humanos , Hibridomas/inmunología , Hígado/inmunología , Ratones , Ratones Endogámicos BALB C , PlásmidosRESUMEN
In the present study, solid phase enzyme immunoassay utilizing antibodies against synthetic IL-2 peptides was used for quantitative measurements of human recombinant and lymphoid IL-2 preparations. The 27-peptide MCF-III-6 (Leu-Glu-His-Leu-Leu-Leu-Asp-Leu-Gln-Met-Ile-Leu-Asn-Gly-Ile-Asn-Asn-- Tyr-Lys-Asn-Pro-Lys-Leu-Thr-Arg-Met-Leu) that comprises the region 14-40 from the IL-2 amino acid sequence was synthesized and used for immunization of rabbits. Resulting anti-MCF-III-6 polyvalent rabbit antibodies reacted specifically in EIA up to dilution of 10(-7) with the MCF-III-6 peptide used for immunization as well as with 16-peptide I-16 (Cys-Nle-Gly-Ile-Asn-Asn-Tyr-Lys-Asn-Pro-Lys-Leu-Thr-Arg-Met-Leu) that comprises the region 27-40 from the IL-2 amino acid sequence. The anti-MCF-III-6 antibody reacted also with human recombinant IL-2 preparations obtained from three producers (Cetus, Riga and Amersham), to the concentration of 0.1 ng/ml, and with various human lymphoid IL-2 preparations. Direct correlation was observed between quantitative measurements of human lymphoid IL-2 by EIA and by CTLL bioassay. It can be concluded that utilization of synthetic IL-2 peptides provides a suitable and comparatively unexpensive immunogen for the production of IL-2 antibodies and that the solid phase EIA using such antibodies can be employed as a rapid, reproducible, and sensitive method for quantitative examination of both recombinant and lymphoid IL-2 preparations.
Asunto(s)
Técnicas para Inmunoenzimas , Interleucina-2/análisis , Péptidos/síntesis química , Proteínas Recombinantes/inmunología , Secuencia de Aminoácidos , Animales , Anticuerpos/análisis , Línea Celular , Humanos , Interleucina-2/inmunología , Activación de Linfocitos , Datos de Secuencia Molecular , Péptidos/inmunología , Conejos , Linfocitos T/inmunologíaRESUMEN
Structural aspects of ribosomal recognition of initiation sites on messenger RNA in procaryotes are considered. Location of initiation sites on mRNA, their length, typical nucleotide sequences that build up the initiation signal, and also the influence of the macrostructure of mRNA on protein synthesis are discussed. Determined nucleotide sequences of mRNA and DNA flanking the origin of different phage and bacterial genes are given.
Asunto(s)
Bacterias/genética , Iniciación de la Cadena Peptídica Traduccional , ARN Mensajero/genética , Secuencia de Bases , Genes , Genes Virales , Fagos ARN/genéticaRESUMEN
Several nucleoside 5'-triphosphate analogs were investigated as inhibitors of human hepatitis B virus replication. Different analogs inhibited DNA synthesis differently, 3'-azido-2',3'-dideoxythymidine 5'triphosphate being the most active compound. This inhibitor blocked DNA synthesis by 50% at inhibitor: substrate molar ratio 1:8, and by 80% - at 1:1. The hypothesis is formulated that 3'-azido-2',3'-dideoxythymidine 5'-triphosphate inhibits RNA directed viral DNA replication due to incorporation of this compound into 3'-termini of newly synthesized DNA chains. The phenomenon observed opens new possibilities for chemotherapy of acute and chronic human hepatitis B.
Asunto(s)
Antivirales , Virus de la Hepatitis B/fisiología , Replicación Viral/efectos de los fármacos , Zidovudina/farmacología , Replicación del ADN/efectos de los fármacos , ADN Viral/efectos de los fármacos , Electroforesis en Gel de Agar , HumanosRESUMEN
Partial digestion with T1 RNAase and chemical modification with kethoxal were used to study stability of two hairpin in the proposed secondary structure of the functionally active MS2 RNA fragment MS2 R(--53 leads to 6), containing the regulatory region of the phage replicase cistron. Analysis of the products obtained after the above treatments showed that T1 RNAase and kethoxal attacked predominantly the guanosine residues in the hairpin b of the MS2 R(--53 leads to 6). This implies that in contrast to the structurally stable hairpin a of the polynucleotide, hairpin b appears to be more labile and may exist under the present experimental conditions in equilibrium with its open form. The data of the competition experiments demonstrated that the kethoxal modified MS2 R(-53 leads to 6) and shorter polynucleotide MS2 R(-53 leads to-11) obtained from MS2 R(-53 leads to 6) after T1 RNAase digestion failed to bind with MS2 coat protein. The relatively unstable hairpin b region in the polynucleotide MS2 R(-53 leads to 6) is suggested to play essential role in the complex formation.
Asunto(s)
Aldehídos , Antivirales , Colifagos/análisis , ARN Nucleotidiltransferasas/metabolismo , ARN Viral , ARN Polimerasa Dependiente del ARN/metabolismo , Ribonucleasa T1 , Ribonucleasas , Secuencia de Bases , Butanonas , Estabilidad de Medicamentos , Guanosina/análisis , Conformación de Ácido Nucleico , Oligorribonucleótidos/análisisRESUMEN
The action of snake venom phosphodiesterase on bacteriophage MS2 RNA under conditions of limited hydrolysis has been studied. The content of 5'-mononucleotides released during hydrolysis does not correspond to the calculated one based on the 3'-terminal nucleotide sequence of MS2 RNA. This finding suggests the occurrence of endonucleolytic splits in MS2 RNA with concomitant exonucleolytic digestion of some newly formed fragments. A high molecular weight RNA fraction, comprising unfragmented MS2 RNA with about 5-63'-terminal nucleotides removed is separated by sucrose gradient centrifugation and shown not to differ from the native MS2 RNA in its template function in a cell-free protein synthesizing system. It is demonstrated that template activity, polarity of translation, and nascent peptide chain termination on the MS2 replicase cistron are not affected by the removal of 3'terminal nucleotides of MS2 RNA. Consequently, these nucleotides are unessential in translation of native MS2 RNA.
Asunto(s)
Colifagos/análisis , ARN Viral , Hidrolasas Diéster Fosfóricas , Biosíntesis de Proteínas , ARN Viral/metabolismo , Ribonucleótidos/análisis , Venenos de Serpiente , Moldes GenéticosRESUMEN
Two types of MS2 particle are revealed when phage lysates are banded in CsCl density gradient. The lower band contain normal phage particles with a density of 1.46 g/cm3. The upper band with a density of 1.44 g/cm3 containes uninfective incomplete MS2 particles. Both phage types reveal no abnormalities in the content of the coat protein and A-protein. They are nearly identical in RNA content. RNA in the normal buoyant density phage particles is native. RNA in the defective particles consists of three specific fragments with molecular weights 6.5-10(5), 5.5-10(5) and 4.4-10(5) and molar ratios 5:4:9 respectively. THE 5'-TERMINAL ANALYSIS OF RNA from defective MS2 particles reveals the presence of native pppGp. THE 3'-TERMINAL ANALYSIS OF THE INDIVIDUAL RNA fragments reveals the presence of adenosine only in the shortest fragment. RNA fragmentation in defective particles can be explained by the action of intracellular RNAses on the unprotected regions on RNA chain in structurally incomplete virions.
Asunto(s)
Bacteriófagos/metabolismo , Pseudomonas/metabolismo , ARN Viral/metabolismo , Secuencia de Bases , Peso Molecular , Mutación , Ribonucleótidos/análisisRESUMEN
2',3'-O-(4-[N-(2-chloroethyl)-N-methylamino]) benzylidene derivative of AUGU6 was used for identification of the proteins in the region of the mRNA-binding centre of E. coli ribosomes. This derivative alkylated ribosomes (preferentially 30S ribosomal) with high efficiency within the 70S initiation complex. In both 30S and 50S ribosomal subunits proteins and rRNA were modified. Specificity of the alkylation of ribosomal proteins and rRNA with the reagent was proved by the inhibitory action of AUGU6. Using the method of two-dimensional electrophoresis in polyacrylamide gel the proteins S4, S12, S13, S14, S15, S18, S19 and S20/L26 which are labelled by the analog of mRNA were identified.
Asunto(s)
Compuestos de Bencilideno/farmacología , Escherichia coli/metabolismo , Oligorribonucleótidos/farmacología , Iniciación de la Cadena Peptídica Traduccional , ARN Bacteriano/metabolismo , ARN Mensajero/metabolismo , Ribosomas/metabolismo , Alquilación , Compuestos de Bencilideno/metabolismo , Sitios de Unión , Electroforesis en Gel de Poliacrilamida , Oligorribonucleótidos/metabolismo , Proteínas Ribosómicas/metabolismo , Factores de TiempoRESUMEN
A series of plasmids with tetracycline resistance genes (Tcr-operon) subjected to transcription from chloramphenicol acetyl transferase promoter (Cmr-promoter) have been constructed on the basis of plasmid pBR325, AprCmrTcr. For this purpose, a 0.8 Md fragment in pBR325 DNA bordered by unique EcoRI and HindIII restriction sites was cut out and structural genes of Tcr-operon were fused to the cat gene nucleotides corresponding to Cmr-promoter and first 72 amino acids of cat (alton, Vapnek, 1979; Marcoli et al., 1980). These plasmids with molecular weight amounting to 3 Md confer AprTcr phenotype to host cells. Tetracycline resistance can be eliminated completely by the deletion of a) Cmr-promoter; b) part of the first Tcr-operon gene.
Asunto(s)
Acetiltransferasas/genética , Escherichia coli/genética , Genes Bacterianos , Plásmidos , Tetraciclina , Cloranfenicol O-Acetiltransferasa , Farmacorresistencia Microbiana , Peso Molecular , Recombinación Genética , Transcripción GenéticaRESUMEN
Preparative RNA-ligase synthesis of decaribonucleotides, the 5'-and 3'-constituent parts to be used for the synthesis of 20-base polyribonucleotides] simulating minimal translation initiation regions for phage RNA was carried out. The decamers were obtained via appropriate heptamers also by RNA-ligase catalyzed synthesis. Apart from decamers used to prepare the functionally active 20-base polyribonucleotide, the minimal translation initiation region of the replicase gene (R) in MS2 and fr phage--sequence R(-17----3) and two its variants, decanucleotides for other template modification were also synthesized. Three 5'-terminal decamers were isolated and identified including the natural decamer ApApApCpApUpGpApGpG (-17----(-)8) and those with G(-9)----A(-9) and U(-12)----C(-12) nucleotide substitutions, as well as three 3'-terminal products differing from the natural region ApUpUpCpCpCpApUpG (-7----3) in MS2 RNA by U(-6)----A(-6), U(-6)U(-5)----A(-6)A(-5) and CCC----UUU (-3----(-)1) substitutions.