First Report of Tomato yellow leaf curl virus Infecting Common Bean in China.

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

A genetically determined insertion/deletion related polymorphism in human T cell receptor beta chain (TCRB) includes functional variable gene segments.

Polymorphism in the human T cell receptor beta chain (TCRB) gene complex includes haplotypes with different numbers of TCRBV genes. An insertion/deletion related polymorphism (IDRP) in the human TCRBV region was found to involve TCRBV gene segments. Inserted TCRB haplotypes contain an additional 21.5 kb in which three TCRBV genes are encoded, members of the TCRBV7, TCRBV9, and TCRBV13 families. Two TCRBV gene segments were present only in inserted haplotypes; one of these, TCRBV7S3, is a functional gene and the other, TCRBV9S2(P), is a pseudogene because of an inframe termination colon. In addition, inserted haplotypes contain two identical copies of the TCRBV13S2 gene, whereas deleted haplotypes have only one copy. Deleted haplotypes could be subdivided into two types, deleted*1 and deleted*2, on the basis of sequence variations in TCRBV6S7 and TCRBV13S2 genes. Both deleted*1 and deleted*2 haplotypes contained the same number of TCRBV genes; both contain 60 genes of which 50 are functional, whereas, inserted haplotypes contained 63 genes of which 52 are functional. Comparisons of inserted region sequences with the homologous region in a deleted haplotype, and with sequences surrounding related TCRBV genes, revealed patterns of similarity that suggest insertion as well as deletion events have occurred in the evolution of the TCRBV gene complex. These data indicate that the genomic TCR repertoire is expanded in individuals who have inserted TCRBV haplotypes. The presence of additional TCRBV genes or, alternatively, the absence of certain TCRBV genes may have an impact upon immune responses and susceptibility to autoimmune diseases.

Selection of rabbit CD4- CD8- T cell receptor-gamma/delta cells by in vitro transformation with human T lymphotropic virus-I.

In vitro transformation of rabbit peripheral blood mononuclear cells (PBMC) with human T lymphotropic virus-I (HTLV)-infected human or rabbit cells resulted in CD4- CD8- cell lines, some of which caused acute leukemia when injected into rabbits. Structural analyses of the proviruses from cell lines with diverse pathogenic effects provided no clear correlation with lethality. The rabbit lines were provisionally designated T cells because they express interleukin 2R (IL-2R) and CD5 and lack surface immunoglobulin, but none express functional T cell receptor (TCR) alpha or beta transcripts. A more detailed characterization of the HTLV-I-infected cells was required to determine cell lineage and its potential influence on pathogenic consequences. Probes for rabbit TCR gamma and delta genes were derived and used to detect gamma and delta TCR RNA transcripts, identifying the in vitro transformed lines as gamma/delta T cells. CD4+ and CD8+ lines were derived from PBMC of HTLV-I-infected rabbits and CD4+ TCR-alpha/beta HTLV-I lines were derived from rabbit thymus, eliminating the possibility that the HTLV-I isolates used here transform only CD4- CD8- TCR-gamma/delta cells. The percentage of gamma/delta cells in rabbit PBMC is relatively high (23% in adult rabbits); this with diminution of CD4+ and CD8+ cells in IL-2-supplemented PBMC or thymocyte cultures may account for selection of rabbit HTLV-I-infected gamma/delta T cell lines in vitro. The availability of well-characterized T cell lines with diverse in vivo effects in the rabbit HTLV-I disease model allows evaluation of roles played by cell type in HTLV-I-mediated disease.

Serologic and molecular characterization of the B(A) blood group in the Chinese population.

B(A) phenotype individuals have normal B antigen and a small amount of A antigen on the RBCs with anti-A in the plasma. Some highly potent monoclonal anti-A reagents are capable of agglutinating B(A) RBCs, which therefore usually results in a discrepancy between RBC and plasma ABO grouping. To date, five B(A) alleles (ABO B(A)01, B(A)02, B(A)03, B(A)04, and B(A)05) have been defined by nucleotide sequences. To get a more complete picture of B(A) phenotypes found in the Chinese population and resolve blood donor typing problems caused by B(A) alleles,a serologic and molecular study of nine unrelated Chinese individuals and three families carrying B(A) alleles was conducted. Allele B(A)02 with a 700C>G mutation, allele B(A)04 with a single 640A>G substitution, and allele B(A)05 with a 641T>C mutation were detected in multigenerational families and unrelated blood donors. Neither the B(A)01 nor B(A)03 alleles with 703A>G substitutions were observed in this study. In addition, a polymerase chain reaction with a sequence-specific primer genotyping assay was developed for rapid identification of B(A)02, B(A)04, and B(A)05 alleles using genomic DNA samples.

Passage of human T-cell leukemia virus type-1 during progression to cutaneous T-cell lymphoma results in myelopathic disease in an HTLV-1 infection model.

Studies comparing functional differences in human T-cell leukemia virus type 1 (HTLV-1) clones that mediate distinct outcomes in experimentally infected rabbits, resulted in a dermatopathic smoldering adult T-cell leukemia/lymphoma following chronic infection with HTLV-1 strain RH/K34. During the 3.5 years' follow-up, HTLV-1 skin disease progressed to cutaneous T-cell lymphoma. When infection was passed to several naive rabbits, progressive paraparesis due to myelopathic neurodegeneration, analogous to HTLV-associated myelopathy, resulted in one of 4 transfusion recipients. Similar proviral loads were detected in the two diseases, regardless of stage of progression or tissue compartment of infection. Complete proviral sequences obtained from the donor and affected recipient aligned identically with each other and with the inoculated virus clone. Existence of disparate pathogenic outcomes following infectious transmission further extends the analogy of using rabbits to model human infection and disease. Although the experimental outcomes shown are limited by numbers of animals affected, they mimic the infrequency of HTLV-1 disease and authenticate epidemiological evidence of virus sequence stability regardless of disease phenotype. The findings suggest that further investigation of a possible role for HTLV-1 in some forms of cutaneous T-cell lymphoma is warranted.

Replication of HIV type 1 in rabbit cell lines is not limited by deficiencies in tat, rev, or long terminal repeat function.

HIV-1 infection has been documented in rabbits, but infection proceeds slowly in this species. Human and rabbit cell lines were compared in order to identify barriers to efficient HIV-1 infection of rabbit cells. A direct comparison of human and rabbit CD4 as receptor for HIV-1 indicated that the rabbit CD4 homolog did not function well even when expressed by human cells. Examination of viral RNA production indicated that the major HIV transcripts were produced in HIV-infected rabbit cells, but were present at levels significantly lower than those found for human cells. Ability of HIV-1 LTRs to direct protein expression in human and rabbit cells was compared using gene constructs with the chloramphenicol acetyltransferase (cat) gene flanked by HIV-1 LTRs. Chloramphenicol acetyltransferase protein expression was equivalent in rabbit and human cell lines transfected with the HIV-1/CAT constructs and cotransfections with the HIV-1 tat gene led to similar increases in CAT expression. Subsequent transfections with an infectious molecular HIV clone yielded approximately equal levels of HIV protein expression in rabbit and human cell lines, suggesting that major barriers to virus production in rabbit lines exist at steps prior to transcription of the viral genome. Because HTLV-I replicates with high efficiency in rabbit cells, a chimeric virus clone was constructed consisting of the 5' portion of HIV-1 through the nef coding sequence followed by the 3' HTLV-I LTR. Transfection of most rabbit cell lines with the chimera produced levels of p24gag protein higher than those transfected with the parent HIV-1 clone. By contrast, the unmodified HIV clone replicated more efficiently in all human cell lines tested.

Source and route of exposure influence infectivity of a molecular clone of human T cell leukemia virus type I.

Infection with human T cell leukemia virus type I (HTLV-I) is typically asymptomatic, but does result in diverse diseases ranging from adult T cell leukemia to spastic neuromyelopathy. To date, differences in HTLV-I provirus structure have not been correlated with pathogenic or asymptomatic outcome of infection. Molecular clones of HTLV-I are now available and represent a powerful tool to link virus structure to pathogenesis. Present studies to explore in vivo infectivity and pathogenicity of an HTLV-I molecular clone, K30p, have utilized the rabbit as a model system. This clone was administered to neonatal or adult rabbits by several different routes and infectivity and pathogenicity were examined. Detection of antiviral humoral immune responses, presence of provirus in tissue samples, and isolation of virus in cultures of blood lymphocytes were used to establish systemic HTLV-I infection. Intramuscular, but not nervous system, exposure to K30p HTLV-I naked DNA resulted in infection. Conversely, neural exposure to T cells that had been transfected with the K30p HTLV-I DNA consistently resulted in systemic infection. Despite detection of HTLV-I provirus in brain and spinal cord of some infected rabbits, no clinical or neuropathological changes occurred. Source and route of virus exposure played a role in infectivity, but did not influence the pathogenic outcome of HTLV-I infection.

Evidence for humoral and cellular reactivity against keratin and thyroglobulin in HTLV-I infected rabbits.

Human T cell leukemia virus type I (HTLV-I) infection was initially associated with T cell leukemia and a progressive neurologic disease but has since been linked to an increasing number of autoimmune disorders, including Sjogren's syndrome, uveitis, and polyarthritis. A survey of serum samples from a rabbit model of HTLV-I infection revealed that all had antibodies against keratin and thyroglobulin. Sera from several infected rabbits also reacted with collagen, while antibody reactions with other autoantigens tested, including DNA, were rare and sporadic. In addition to antibodies, cellular reactivity to keratin, but not thyroglobulin, was demonstrated by cellular proliferation in presence of IL-2 and keratin. Expanded cell cultures were positive for T cell activation markers and CD8. Association of the auto-reactivity with HTLV-I infection rather than random anti-cellular responses was supported by the fact that no antikeratin or antithyroglobulin was seen in uninfected controls, including that inoculated with uninfected lymphocytes. Finding autoantibodies in rabbits infected using naked HTLV-I DNA clones provided further assurance that infection induced the autoimmune reactions detected.

[Study on immunoglobulin allotypes in the Chinese: a hypothesis of the origin of the Chinese nation].

This paper reports the distribution of immunoglobulin Gm and Km allotypes in 74 Chinese geographic populations. These populations are derived from 24 nationalities comprising 96.6% of the total population of China. A total of 9,560 individuals were phenotyped for Gm (1,2,3,5,21) factors and 9,611 for Km(1). Phylogenetic trees were constructed on the basis of Gm haplotype frequencies and genetic distances. The results of clustering analysis show the heterogeneity of the Chinese nation, and confirm the hypothesis that the modern Chinese nation originated from two distinct populations. One population originating in the Yellow River valley, and the other originating, in the Yangtze River valley during the early part of neolithic times (to date 3,000--7,000). Frequencies of the Gm haplotype of 74 Chinese populations were compared with those from 33 populations from major racial groups. The results suggest that during human evolution, the Negroid group and Caucasoid-Mongoloid group diverged first, followed by a divergence between the Caucasoid and Mongoloid. Interrace divergences are high in comparison with interrace divergences. There appear to be two distinct subgroups of Mongoloid, Northern and Southern Mongoloid. The Northern and Southern Mongoloid have Gm1;21 and Gm1,3;5 haplotypes as race associated markers, respectively. Furthermore, the Caucasian associated haplotype Gm3;5 was found in several of the minorities living in the northwest part of China. The amount of Caucasian admixture has been estimated. The presence of the Gm3;5 haplotype is attributed to the Caucasians living in Central Asia throughout the "Silk Road." In contrast to the Gm haplotype distribution, Km1 gene frequencies showed a random distribution in the populations studied.

Establishment of an HPA-1- to -16-typed platelet donor registry in China.

In order to determine gene frequencies of human platelet antigen (HPA) and establish a panel of accredited HPA-1a, -2a, -4a, -5a and -6a-negative donors as well as an HPA-typed platelet donor registry, a total of 1000 Chinese donors of Han nationality (500 from north China and 500 from south China) were typed for HPA-1 through -16 using a DNA-based polymerase chain reaction with sequence-specific primers genotyping method. The gene frequencies of HPA-1b, -2b, -3b, -4b, -5b, -6bw, -10bw and -15b were 0.0060, 0.0485, 0.4055, 0.0045, 0.0140, 0.0135, 0.0005 and 0.4680, respectively. The HPA-7bw, -8bw, -9bw, -11bw, -12bw, -13bw, -14bw and -16bw alleles were not found. The HPA-2b and -5b homozygous donors were detected at low frequencies. The HPA mismatch probabilities potentially leading to alloimmunization in random platelet transfusion vary with a region from 0.1% to 37% depending on the distribution patterns of common and less common alleles in each system. This study provides a useful HPA-typed plateletpheresis donor registry in China and could improve platelet antibody detection and HPA-matched platelet transfusion in alloimmune thrombocytopenic patients.

Characterization of HLA-B*5516, -B*1313, -B*9512, and -DRB1*1457 alleles identified in a southwest Chinese population.

The human leukocyte antigen (HLA)-B*5516 allele differs from the B*5502 by a single 97 T --> C substitution (His to Tyr at position 33) in exon 2. The B*1313 allele results from 419 T --> A and 420 A --> C substitutions, encoding a Leu to Tyr substitution at 140 in exon 2 of the B*1301 allele. The B*9512 allele differs from B*1502 by a single 360 G --> C substitution (Gln to His at 120) in exon 3. The DRB1*1457 allele appears to be a hybrid molecule generated by recombination between the DRB1*13 and DRB1*14 alleles. The serological equivalents of these new alleles are HLA-B22, -B13, -B15, and DR13, respectively. Family studies detected two rare haplotypes: A*11, B*9512, DRB1*14 and A*24, B*52, Cw*07, DRB1*1457, DRB3*020201, DQB1*050301. The gene frequencies of these alleles in the Chinese population are less than 0.0001.

Identification of a novel HLA-A*0278 allele in a Chinese family.

A novel human leukocyte antigen-A (HLA-A) allele, A*0278, has been identified in a Chinese family using DNA-based typing and molecular cloning methods. The alleles A*0278 differs from its closest matching HLA sequence of A*0256 by a silent substitution at 102 A > C and by two replacement substitutions, 98T > A and 292 C > G in exon 2, resulting in a change of codon 33 from Phe (TTC) to Tyr (TAC) and codon 98 from His (CAC) to Asp (GAC). Serology study revealed that A*0278 is associated with HLA-A2 broad specificity. A polymerase chain reaction-sequence-specific primers-based assay was developed to identify A*0278. Family study indicated that the propositus inhered his father's HLA haplotype A*0278, B*35, DRB1*15. No further individuals of A*0278 were found in 5000 Chinese bone marrow donor volunteers.

Evidence for CSH1, a variant of Cw3, in an Oriental population.

There have recently been a number of reports on Cw3 variants. By using 9th International Histocompatibility Workshop (9 IHW) sera to study 18 Chinese families, we were able to identify three distinct Cw3 patterns: Cw3.1, Cw3.2 and CSH1. CSH1 appears to be that component at the broad Cw3 determinant that is shared with the broad Cw1 determinant. With 9 IHW sera, we were able to distinguish between Cw1 and Cw3 traveling on the same haplotype from Cw1 and Cw3 traveling on different haplotypes.

Evidence for existence of ST-16 specificity in Chinese.

The two new HLA-B specificities ST-16 and SH6 were defined for the first time with the local sera in Mexican-Americans and Chinese, respectively. Using the 9th Workshop sera, it was confirmed that SH6, Bw6-associated split of B16, was serologically identical to ST-16.

Gm and Km allotypes in 74 Chinese populations: a hypothesis of the origin of the Chinese nation.

This paper reports the distribution of immunoglobulin Gm and Km allotypes in 74 Chinese geographical populations. These populations are derived from 24 nationalities comprising 96.6% of the total population of China. A total of 9,560 individuals were phenotyped for Gm(1,2,3,5,21) factors, and 9,611 were phenotyped for Km(1). Phylogenetic trees were constructed on the basis of Gm haplotype frequencies and genetic distances. The results of cluster analysis show the heterogeneity of the Chinese nation, and confirm the hypothesis that the modern Chinese nation originated from two distinct populations, one population originating in the Yellow River valley and the other originating in the Yangtze River valley during early neolithic times (3,000-7,000 years ago). Frequencies of the Gm haplotype of 74 Chinese populations were compared with those of 33 populations from major racial groups. The results suggest that during human evolution, the Negroid group and Caucasoid-Mongoloid group diverged first, followed by a divergence between the Caucasoid and Mongoloid. Interrace divergence is high in comparison with intrarace divergence. There appear to be two distinct subgroups of Mongoloid, northern and southern Mongoloid. The northern and southern Mongoloid have Gm1;21 and Gm1,3;5 haplotypes as race-associate markers, respectively. Furthermore, the Caucasian-associated haplotype Gm3;5 was found in several of the minorities living in the northwest part of China. The presence of the Gm3;5 haplotype is attributed to the Caucasians living in Central Asia throughout the Silk Road. The amount of Caucasian admixture has been estimated. In contrast to the Gm haplotype distribution, Km1 gene frequencies showed a random distribution in the populations studied.