Comprehensive metabolome characterization of leaves, internodes, and aerial roots of Vanilla planifolia by untargeted LC-MS and GC × GC-MS.

INTRODUCTION: Untargeted metabolomics is a powerful tool that provides strategies for gaining a systematic understanding of quantitative changes in the levels of metabolites, especially when combining different metabolomic platforms. Vanilla is one of the world's most popular flavors originating from cured pods of the orchid Vanilla planifolia. However, only a few studies have investigated the metabolome of V. planifolia, and no LC-MS or GC-MS metabolomics studies with respect to leaves have been performed. OBJECTIVE: The aim of the study was to comprehensively characterize the metabolome of different organs (leaves, internodes, and aerial roots) of V. planifolia. MATERIAL AND METHODS: Characterization of the metabolome was achieved using two complementary platforms (GC × GC-MS, LC-QToF-MS), and metabolite identification was based on a comparison with in-house databases or curated external spectral libraries. RESULTS: In total, 127 metabolites could be identified with high certainty (confidence level 1 or 2) including sugars, amino acids, fatty acids, organic acids, and amines/amides but also secondary metabolites such as vanillin-related metabolites, flavonoids, and terpenoids. Ninty-eight metabolites showed significantly different intensities between the plant organs. Most strikingly, aglycons of flavonoids and vanillin-related metabolites were elevated in aerial roots, whereas its O-glycoside forms tended to be higher in leaves and/or internodes. This suggests that the more bioactive aglycones may accumulate where preferably needed, e.g. for defense against pathogens. CONCLUSION: The results derived from the study substantially expand the knowledge regarding the vanilla metabolome forming a valuable basis for more targeted investigations in future studies, e.g. towards an optimization of vanilla plant cultivation.

Impact of the Post-Harvest Period on the Chemical and Sensorial Properties of planifolia and pompona Vanillas.

Vanilla production in Guadeloupe is expanding. The main species grown is Vanilla planifolia, but other species such as Vanilla pompona are also present and required by industries. To upgrade the value of vanilla production on this Caribbean Island, this study was performed to evaluate the aromatic specifies of these vanilla species according to the length of the post-harvest period (2 months and 9 months). For this purpose, Vanilla planifolia and Vanilla pompona were compared through scald and scarification transformation processes, as well as two different refining times (T1 and T2). For chemical characterization, 0.1 g of vanilla bean seeds was used for SMPE/GC-MS measurements, while 0.05 g of vanilla samples was subjected to infusion in milk (0.15%) for sensory evaluation. The latter involved generation of terms of aroma through olfaction and gustation sessions. The chemical results showed a significant difference between the two species, where vanillin was mostly present in Vanilla planifolia, unlike Vanilla pompona, where it was mainly rich in 4-methoxybenzyl alcohol. Interestingly, the second refining time was characterized by the appearance of two major components, 1,3-octadien and acetic acid. For sensory analysis, all the vanillas exhibited a high diversity of aromas including "sweet", "gourmand", "spicy" flavors and so on. The application of factorial correspondence analysis (FAC) as well as the agglomerative hierarchical clustering (AHC) showed differences between the vanilla samples according to both the species and refining time. The combination of these analyses makes it possible to establish a chemical and organoleptic profile of vanillas. Varietal and processing factors both have a major impact on the aroma profile of vanillas.

First Vanilla planifolia High-Density Genetic Linkage Map Provides Quantitative Trait Loci for Resistance to Fusarium oxysporum.

Fusarium oxysporum f. sp. radicis-vanillae (Forv), the causal agent of root and stem rot disease, is the main pathogen affecting vanilla production. Sources of resistance have been reported in Vanilla planifolia G. Jackson ex Andrews, the main cultivated vanilla species. In this study, we developed the first high-density genetic map in this species with 1,804 genotyping-by-sequencing (GBS)-generated single nucleotide polymorphism (SNP) markers using 125 selfed progenies of the CR0040 traditional vanilla cultivar. Sixteen linkage groups (LG) were successfully constructed, with a mean of 113 SNPs and an average length of 207 cM per LG. The map had a high density with an average of 5.45 SNP every 10 cM and an average distance of 1.85 cM between adjacent markers. The first three LG were aligned against the first assembled chromosome of CR0040, and the other 13 LG were correctly associated with the other 13 assembled chromosomes. The population was challenged with the highly pathogenic Forv strain Fo072 using the root-dip inoculation method. Five traits were mapped, and 20 QTLs were associated with resistance to Fo072. Among the genes retrieved in the CR0040 physical regions associated with QTLs, genes potentially involved in biotic resistance mechanisms, coding for kinases, E3 ubiquitin ligases, pentatricopeptide repeat-containing proteins, and one leucine-rich repeat receptor underlying the qFo72_08.1 QTL have been highlighted. This study should provide useful resources for marker-assisted selection in V. planifolia.

Calcium lignosulfonate modulates physiological and biochemical responses to enhance shoot multiplication in Vanilla planifolia Andrews.

Utilisation of calcium lignosulfonate (CaLS) in Vanilla planifolia has been reported to improve shoot multiplication. However, mechanisms responsible for such observation remain unknown. Here, we elucidated the underlying mechanisms of CaLS in promoting shoot multiplication of V. planifolia via comparative proteomics, biochemical assays, and nutrient analysis. The proteome profile of CaLS-treated plants showed enhancement of several important cellular metabolisms such as photosynthesis, protein synthesis, Krebs cycle, glycolysis, gluconeogenesis, and carbohydrate synthesis. Further biochemical analysis recorded that CaLS increased Rubisco activity, hexokinase activity, isocitrate dehydrogenase activity, total carbohydrate content, glutamate synthase activity and total protein content in plant shoot, suggesting the role of CaLS in enhancing shoot growth via upregulation of cellular metabolism. Subsequent nutrient analysis showed that CaLS treatment elevated the contents of several nutrient ions especially calcium and sodium ions. In addition, our study also revealed that CaLS successfully maintained the cellular homeostasis level through the regulation of signalling molecules such as reactive oxygen species and calcium ions. These results demonstrated that the CaLS treatment can enhance shoot multiplication in V. planifolia Andrews by stimulating nutrient uptake, inducing cell metabolism, and regulating cell homeostasis. Supplementary Information: The online version contains supplementary material available at 10.1007/s12298-023-01293-w.

Microbial Diversity in Cultivated and Feral Vanilla Vanilla planifolia Orchids Affected by Stem and Rot Disease.

The worldwide production of vanilla, a native orchid from Mexico, is greatly affected by stem and root rot disease (SRD), typically associated with Fusarium oxysporum fungi. We hypothesized that the presence of Fusarium species in vanilla is not sufficient for the plant to express symptoms of the disease. We described the taxonomic composition of endophytic microbiomes in symptomatic and asymptomatic vanilla plants using 16S and ITS rDNA metabarcoding, and ITS Sanger sequences generated from fungal isolates. We compared the bacterial and fungal diversity in vanilla plants from a long-term plantation, and from feral plants found near abandoned plantations that did not present SRD symptoms. No significant differences were found in the species richness of the bacterial and fungal microbiome among feral, or asymptomatic and symptomatic cultivated vanilla. However, significant differences were detected in both fungal and bacterial diversity from different organs in the same plant, with roots being more diverse than stems. We found that Proteobacteria and Actinobacteria, as well as the fungal families Nectriaceae and Xylariaceae, constitute the core of the vanilla microbiome that inhabits the root and stem of both cultivated and feral plants. Our work provides information on the microbial diversity associated to root and stem rot in vanilla and lays the groundwork for a better understanding of the role of the microbiome in vanilla fungal diseases.

First report of Odontoglossum ringspot virus in Vanilla (Orchidaceae) in Madagascar.

Vanilla (Vanilla planifolia, Orchidaceae) is Madagascar's leading agricultural export resource which provides 80% of world's consumption. During a phytosanitary survey conducted from November 2019 to March 2021 in the main vanilla production regions of Madagascar, 250 plots were indexed for cymbidium mosaic virus (CymMV, Potexvirus genus) and odontoglossum ringspot virus (ORSV, Tobamovirus genus) the two most prevalent viruses of cultivated orchids worldwide (Zettler et al., 1990). For each plot, bulk samples (ten leaves taken at random) were assayed using Immunostrips (AGDIA, ISK 13301). A quarter of the plots (63/250) tested positive for CymMV. The highest prevalence of CymMV was observed in the SAVA region (57 out of 153 plots = 37,2%) where the virus has been reported since 1997 (Grisoni et al., 2010). Six plots located in the district of Mahanoro (Atsinanana) tested positive for ORSV. A few plants in these plots showed chlorotic often annular spots on their leaves. They were individually tested positive for ORSV, and negative for CymMV and potyviruses (Immunostrips AGDIA ISK 27200), the other two viruses reported so far in vanilla in Madagascar. To confirm the diagnosis of ORSV, leaf samples from five of the six infected plots were analysed by Tube Capture-RT-PCR (Grisoni et al., 2017) using two pairs of primers flanking the ORSV coat protein (CP) gene: OrCP1 (GGTCGGTAATGGTGTTAG) / OrCP2 (TGCATTATCGTATGCTCC), and CPOR-F(ATGTCTTACACTATTACAGACC) / CPOR-R(TTAGGAAGAGGTCCAAGTAAG). The five samples gave amplicons of the expected size (820 nt and 476 nt, respectively) and were sequenced with Sanger technology (Macrogen, The Netherlands). The ORSV-CP sequences of the Mahanoro isolates showed very close similarity to 198 ORSV-CP sequences from GenBank (95.8% to 99.6% nucleotide and 94.5 to 100% amino-acid identities), and less than 75.4% nucleotide (80.1% amino-acid) identities with Bell pepper mosaic virus (DQ355023), the tobamovirus closest to ORSV. The five ORSV-CP sequences from vanilla were deposited in GenBank under accessions numbers OM847399 to OM847403. These data confirmed that ORSV infects vanilla vines in Madagascar. To our knowledge, this is the first report of this virus in Madagascar and of its ability to infect symptomatically V. planifolia. The five ORSV isolates from vanilla had more than 98.7 % nucleotide identities of CP gene and clustered into a monophyletic group in maximum likelihood phylogenetic tree, suggesting a single origin of these isolates. To further investigate the origin of ORSV in Madagascar, we made use of RNA sequences isolated at different points in time to infer the timing of evolutionary events (Rieux et al., 2016). We estimated the CP gene substitution rate to 4.8E-4 subst/site/year [95%HPD 2.1E-4 - 8.7E-4] which is close to the estimate of He et al. (2019) based on a slightly different sequences set (1.25E-3 subst/site/year). We dated the initial contamination of vanilla plts by ORSV between 2004 and 2013. Both ORSV and CymMV have deleterious effects on many ornamental orchids, and the pathogenicity of CymMV is exacerbated when co-infecting with ORSV (Lee et al., 2021). Therefore, ORSV represents a new threat to the Malagasy vanilla crop, especially in regions where CymMV is already rife. Given the economic importance of vanilla cultivation in the country, the implementation of prophylactic measures aimed at preventing the spread of ORSV, in particular through the sanitary control of cuttings, should be a priority for the vanilla industry.

Development of species-specific molecular markers in Vanilla for seedling selection of hybrids.

Vanilla planifolia is the primary botanical source of vanilla extract used globally in various foods and beverages. V. planifolia has a global distribution based on a few foundational clones and therefore has limited genetic diversity. Many Vanilla species easily hybridize with V. planifolia and could be a source of valuable genetic traits like increased vanillin content, disease resistance, or early flowering. While breeding Vanilla hybrids may improve plant performance, basic molecular tools for this species are lacking. DNA-based molecular markers are the most efficient method to validate hybrid progeny, detect hybrids in commercial plantings, and identify unknown accessions. This study used publicly available sequence data to develop species-specific, qRT-PCR-based molecular markers for Vanilla. Over 580,000 assembled sequence fragments were filtered for species specificity and twenty-two targets were selected for qRT-PCR screening. Ten targets differentially amplified among V. planifolia, V. pompona, V. phaeantha, and V. palmarum with ΔCT values as high as 17.58 between species. The ten targets were used to validate the parentage of hybrid progeny from controlled crosses with most hybrid progeny showing amplification patterns similar to both parents. The ten targets were also used to screen sixteen Vanilla species for specificity, and supported species assignments for unknown accessions including the detection of putative hybrids. This is the first report using species-specific, qRT-PCR-based molecular markers in Vanilla. These markers are inexpensive, simple to develop, and can rapidly screen large populations. These methods will enable the further development of species-specific molecular markers when creating Vanilla interspecific hybrid populations.

Blue Light Mediates Chloroplast Avoidance and Enhances Photoprotection of Vanilla Orchid.

Vanilla orchid, which is well-known for its flavor and fragrance, is cultivated in tropical and subtropical regions. This shade-loving plant is very sensitive to high irradiance. In this study, we show that vanilla chloroplasts started to have avoidance movement when blue light (BL) was higher than 20 µmol m-2s-1 and significant avoidance movement was observed under BL irradiation at 100 µmol m-2s-1 (BL100). The light response curve indicated that when vanilla was exposed to 1000 µmol m-2s-1, the electron transport rate (ETR) and photochemical quenching of fluorescence (qP) were significantly reduced to a negligible amount. We found that if a vanilla orchid was irradiated with BL100 for 12 days, it acquired BL-acclimation. Chloroplasts moved to the side of cells in order to reduce light-harvesting antenna size, and chloroplast photodamage was eliminated. Therefore, BL-acclimation enhanced vanilla orchid growth and tolerance to moderate (500 µmol m-2s-1) and high light (1000 µmol m-2s-1) stress conditions. It was found that under high irradiation, BL-acclimatized vanilla maintained higher ETR and qP capacity than the control without BL-acclimation. BL-acclimation induced antioxidant enzyme activities, reduced ROS accumulation, and accumulated more carbohydrates. Moreover, BL-acclimatized orchids upregulated photosystem-II-associated marker genes (D1 and PetC), Rubisco and PEPC transcripts and sustained expression levels thereof, and also maximized the photosynthesis rate. Consequently, BL-acclimatized orchids had higher biomass. In short, this study found that acclimating vanilla orchid with BL before transplantation to the field might eliminate photoinhibition and enhance vanilla growth and production.

Evaluation of in vitro shoot multiplication and ISSR marker based assessment of somaclonal variants at different subcultures of vanilla (Vanilla planifolia Jacks).

The effect of subculture cycles on somaclonal variation of V. planifolia using intersimple sequence repeat (ISSR) markers was analyzed. Nodal segments of 2 cm in length were established in vitro and multiplied by 10 subculture cycles in Murashige and Skoog (MS) medium supplemented with 8.86 µM BAP (benzylaminopurine). After 45 days in each culture, the length and number of shoots per explant were evaluated. For ISSR markers, ten shoots per each subculture and the mother plant were used. Ten ISSR primers were used and a total of 118 bands were obtained. The polymorphism (%) was calculated and a dendrogram based on Jaccard's genetic distance between the subcultures and the donor plant was obtained. These results show that the multiplication rate tends to increase until subculture five, whereas shoot length decreases as the number of subcultures increases. The ISSR markers revealed an increase in the polymorphism percentage after the fifth culture cycle. The dendrogram showed the formation of two groups. The first group, with less genetic variability, is the donor plant and subcultures 1-5; the second group has greater genetic distance and is formed by subcultures 6-10. The results revealed that the number of subcultures with 8.86 µM BAP is a factor that affects the somaclonal variation during in vitro regeneration of V. planifolia. In conclusion, the subculture number affects somaclonal variation and in vitro development of V. planifolia.

Phenylpropanoid 2,3-dioxygenase involved in the cleavage of the ferulic acid side chain to form vanillin and glyoxylic acid in Vanilla planifolia.

Enzyme catalyzing the cleavage of the phenylpropanoid side chain was partially purified by ion exchange and gel filtration column chromatography after (NH4)2SO4 precipitation. Enzyme activities were dependent on the concentration of dithiothreitol (DTT) or glutathione (GSH) and activated by addition of 0.5 mM Fe2+. Enzyme activity for ferulic acid was as high as for 4-coumaric acid in the presence of GSH, suggesting that GSH acts as an endogenous reductant in vanillin biosynthesis. Analyses of the enzymatic reaction products with quantitative NMR (qNMR) indicated that an amount of glyoxylic acid (GA) proportional to vanillin was released from ferulic acid by the enzymatic reaction. These results suggest that phenylpropanoid 2,3-dioxygenase is involved in the cleavage of the ferulic acid side chain to form vanillin and GA in Vanilla planifolia.

Volatile composition and sensory properties of Vanilla × tahitensis bring new insights for vanilla quality control.

BACKGROUND: Vanilla × tahitensis produced in French Polynesia has a unique flavour among vanilla species. However, data on volatiles and sensory properties remain limited. In this study, the volatile composition and sensory properties of V. × tahitensis from three Polynesian cultivars and two origins (French Polynesia/Papua New Guinea) were determined by gas chromatography-mass spectrometry and quantitative descriptive analysis, respectively, and compared to Vanilla planifolia. RESULTS: Vanilla species, origins and cultivars were differentiated by their volatile and sensory profiles using principal component analysis. The V. × tahitensis flavour from French Polynesia was characterized by a well-balanced sensory profile, having strong anise and caramel notes due to high levels of anisyl compounds. V. × tahitensis from Papua New Guinea was distinct from that of French Polynesia, having strong spicy, fruity, brown rum notes due to p-vinylguaiacol, p-cresol and esters. Vanilla planifolia showed stronger phenolic, woody, smoky notes due to guaiacol, creosol and phenol, which were found to be biomarkers of the species. Vanilla sensory properties were linked by partial least squares regression to key volatile compounds like guaiacol or creosol, which are indicators of lower quality. CONCLUSION: This study brings new insights to vanilla quality control, with a focus on key volatile compounds, irrespective of origin.

Phenol homeostasis is ensured in vanilla fruit by storage under solid form in a new chloroplast-derived organelle, the phenyloplast.

A multiple cell imaging approach combining immunofluorescence by confocal microscopy, fluorescence spectral analysis by multiphotonic microscopy, and transmission electron microscopy identified the site of accumulation of 4-O-(3-methoxybenzaldehyde) ß-d-glucoside, a phenol glucoside massively stockpiled by vanilla fruit. The glucoside is sufficiently abundant to be detected by spectral analysis of its autofluorescence. The convergent results obtained by these different techniques demonstrated that the phenol glucoside accumulates in the inner volume of redifferentiating chloroplasts as solid amorphous deposits, thus ensuring phenylglucoside cell homeostasis. Redifferentiation starts with the generation of loculi between thylakoid membranes which are progressively filled with the glucoside until a fully matured organelle is obtained. This peculiar mode of storage of a phenolic secondary metabolite is suspected to occur in other plants and its generalization in the Plantae could be considered. This new chloroplast-derived organelle is referred to as a 'phenyloplast'.

Annual Accumulation of CymMV May Lead to Loss in Production of Asymptomatic Vanilla Propagated by Cuttings.

Vanilla (Vanilla planifolia Andrews) is a valuable orchid spice cultivated for its highly priced beans. Vanilla has been planted in Hainan province of China via cutting propagation for about 40 years. The yield has been decreasing annually for the past ten years due to pod numbers declining significantly even though it seems to grow normally without disease symptoms, while the reason is still unknown. In this study, we found that Cymbidium mosaic virus (CymMV), one of the most devastating viruses causing losses in the vanilla industry, massively presented within the pods and leaves of vanilla plants, so the virus infecting the vanilla seems to be a highly probable hypothesis of the main contributions to low yield via decreasing the number of pods. This represents the first speculation of CymMV possibly affecting the yield of vanilla in China, indicating the important role of virus elimination in restoring high yield in vanilla. This research can also serve as a warning to important economic crops that rely on cuttings for propagation, demonstrating that regular virus elimination is very important for these economically propagated crops through cuttings.

First Gynogenesis of Vanilla planifolia for Haploid Production and Ploidy Verification Protocol.

Vanilla orchids are members of the Vanilloideae orchid subfamily, and they hold significant economic value as a spice crop in tropical regions. Despite the presence of 180 known species within this subfamily, commercial production focuses on only three species (Vanilla planifolia, V. odorata, and V. pompona) and one hybrid (V. × tahitensis), prized for their aromatic qualities and bioactive compounds. Limited modern breeding initiatives have been undertaken with vanilla orchids, although recent advancements in genomic research are shedding light on this crop's potential. The protracted breeding cycle of vanilla, coupled with increasing demand for germplasm, underscores the importance of research and breeding efforts in vanilla. This paper outlines a protocol for haploid production in V. planifolia using unfertilized ovaries in tissue culture conditions. Additionally, we present a methodology to confirm the haploid nature of putative haploid lines through stomatal size comparison, chromosome counting, and flow cytometry analysis, proving the successful development of haploid vanilla plants. These findings contribute to the advancement of breeding programs and genetic improvement strategies for the vanilla industry.

Microstructural Changes in Vanilla planifolia Beans after Using High-Hydrostatic-Pressure Treatment in the Curing Process.

During vanilla bean curing, the cell arrangement derived from the killing technique applied to start bean ripening is essential to obtain the characteristic aroma and flavor of vanilla. Hence, killing is an important step to release the enzymes and compounds required for vanillin production. In this work, high hydrostatic pressure (HHP) at 100-400 MPa for 5 min, using water at 7 °C as the pressure-transmitting medium, was applied as the killing method, and its effect on the microstructural changes in vanilla beans during different curing cycles (C0-C20) was evaluated and compared with that observed after scalding by using water at 100 °C for 8 s. Microstructural changes in the cross-sectioned beans were analyzed using a stereomicroscope (SM), confocal laser scanning microscopy (CLSM), and environmental scanning electron microscopy (ESEM). The vanilla beans were cross-sectioned and three main sectors were analyzed: the total, annular, and core. The morphometric descriptors, namely, area, Feret's diameter, and circularity, were quantified via digital image analysis (DIA), from which a shrinkage ratio was calculated. The results show that the total area in the beans presented a maximum decrease in the C16 of curing. The core area was most affected by the HHP treatment, mainly at 400 MPa, rather than scalding. CSLM observations revealed the autofluorescence of the compounds inside the beans. In conclusion, the use of microscopy techniques and DIA allowed us to determine the microstructural changes in the HHP-treated pods, which were found to be more numerous than those found in the scalded beans.

Microbiome-Metabolomic Analysis Revealed the Immunoprotective Effects of the Extract of Vanilla planifolia Andrew (EVPA) on Immunosuppressed Mice.

This study investigated the immunoprotective effects of the extract of Vanilla planifolia Andrew (EVPA) on cyclophosphamide (Cy)-induced immunosuppression in mice. The results show that EVPA administration significantly alleviated the immune damage induced by Cy, as evidenced by an improved body weight, organ index, and colonic injury. A further analysis of microbial diversity revealed that the EVPA primarily increased the abundance of the beneficial bacteria Verrucomicrobiota, Lactobacillaceae, and Lactobacillus while decreasing Akkermansiaceae, Akkermansia, Romboutsia, and Lactococcus, thereby ameliorating the microbial dysbiosis caused by Cy. A metabolomic analysis revealed significant alterations in the microbial metabolite levels after EVPA treatment, including urobilinogen, formamidopyrimidine nucleoside triphosphate, Cer (d18:1/18:0), pantetheine, and LysoPC (15:0/0:0). These altered metabolites are associated with pathways related to sphingolipid metabolism, carbapenem biosynthesis, pantothenate and CoA biosynthesis, glycerophospholipid metabolism, and porphyrin metabolism. Furthermore, significant correlations were observed between certain microbial groups and the differential metabolites. These findings provide new insights into the immunomodulatory effects of EVPA on the intestinal microbiota and metabolism, laying the foundation for more extensive utilization.

Effect of Microwave and Ultrasound during the Killing Stage of the Curing Process of Vanilla (Vanilla planifolia, Andrews) Pods.

The curing process (CP) of Vanilla planifolia pods, which is a long and tedious process, is necessary to obtain the natural vanilla extract. This research evaluated the application of microwave (M) and ultrasound (U) during the "killing" stage of the CP and its effect on vanillin content and ß-glucosidase activity. The pods were immersed in a container with water or with moistened samples for the M treatments. In U treatments, the pods were immersed in an ultrasonic bath. After this stage, the samples were subjected to an additional U treatment. The results show that the application of these technologies significantly improves vanillin yield (p < 0.05) and the curing time is reduced to 20 days. U treatments subjected to additional sonication at 38 °C obtain more than double the yield of vanillin regarding control. The effect of M and U on cell structure damage increases with additional sonication, but at 15 min, ß-glucosidase inactivation decreases the final yield. Disposition of samples in M also affects the final vanillin content. There is no significant correlation between ß-glucosidase and vanillin in the different treatments. The application of M and U with the appropriate parameters reduces the CP time without affecting the compounds of interest.

Effects of gamma irradiation on morphology and protein differential in M1V1 population of Vanilla planifolia Andrews.

PURPOSE: Lower doses (1-10 Krad) of gamma-rays (γ) are frequently used in obtaining useful mutants in diverse plant species, whereas no report on gamma (γ) irradiation being used to develop new varieties of vanilla from vanilla cuttings. This study assessed the potential of lower doses of gamma-rays for vanilla mutation breeding. MATERIALS AND METHODS: We compared the morphological differences between vanilla plants irradiated at different lower doses of gamma radiation (10, 30, 40, and 50 Gy). We quantified protein and compared variation from the extracted protein of vanilla shoots regenerated between treatments. RESULTS AND CONCLUSIONS: After 44 weeks, the results showed that the growth of M1V1 (mutation 1 in vegetative cycle 1) plants at 0 Gy (control) is highest compared with other doses of gamma radiation in terms of plant height and the number of shoots. However, the highest measurement for root length is at 10 Gy. The slowest growth rate was obtained from 40 to 50 Gy. Based on the unique band of protein that appears on the SDS-PAGE gel, 10 Gy has three unique bands at loci 0.105 RF, two bands lie at loci between 0.164 RF and 0.234 RF. While 30 Gy is absent two unique bands at loci 0.234 RF compared to 0 Gy. Thus, the dose of gamma rays at 10 Gy gave the highest number of protein fragments, which detected polymorphisms between the control (0 Gy) and the plants treated. To our knowledge, this is the first report of the protein variation in M1V1 of irradiated vanilla plants.

Genome-wide identification of the glutamate receptor-like gene family in Vanilla planifolia and their response to Fusarium oxysporum infection.

Glutamate receptor-like genes (GLRs) are essential for plant growth and development and for coping with environmental (biological and non-biological) stresses. In this study, 13 GLR members were identified in the Vanilla planifolia genome and attributed to two subgroups (Clade I and Clade III) based on their physical relationships. Cis-acting element analysis and Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) annotations indicated the GLR gene regulation's complexity and their functional diversity. Expression analysis revealed a relatively higher and more general expression pattern of Clade III members compared to the Clade I subgroup in tissues. Most GLRs showed significant differences in expression during Fusarium oxysporum infection. This suggested that GLRs play a critical role in the response of V. planifolia to pathogenic infection. These results provide helpful information for further functional research and crop improvement of VpGLRs.