Two novel deletion mutations in ß-globin gene cause ß-thalassemia trait in two Chinese families.

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Study of the Inducible Cross-Linking Reaction to mRNA and the Effect on the Translation.

The 4-vinylpyrimidin-2-one nucleoside (T-vinyl) forms a cross-link with the RNA containing uracil at the complementary site at a high reaction rate. To obtain the stable T-vinyl derivative so that its reactivity is protected until it access to the target site, several derivatives were investigated, and the 2-thiopyridinyl- and 2-thiopyrimidinyl T-vinyl derivatives were determined to be good candidates. The 2-thiopyrimidinyl T-vinyl derivative was found to more efficiently cross-link with mRNA albeit having a better stability than the 2-thiopyridinyl T-vinyl derivative. The investigation using the luciferase (Luc) mRNA, the synthetic mRNA and non-cellular translation system revealed that the translation is terminated at the end of the cross-linked duplex between the mRNA and the oligoribonucleotide (ORN). Thus, the 2-thiopyrimidinyl T-vinyl derivative has successfully demonstrated both a good stability and high efficiency for the cross-linking reaction, and expanded its applicability in biological applications.

Derivatives of gecko cathelicidin-related antioxidant peptide facilitate skin wound healing.

Cathelicidins are a class of gene-encoded multifunctional factors in host defence systems. They have recently attracted a great deal of attention as promising drug candidates. Cathelicidins are well studied in vertebrates, yet no studies have been reported concerning gecko cathelicidin. Recently, we identified a novel cathelicidin from Gekko japonicus, Gj-CATH3. Unlike most cathelicidins, Gj-CATH3 exhibits potent antioxidant activity in vitro. Unfortunately, slight toxicity and high synthesis cost restrict its application. Thus, we designed a series of Gj-CATH3 analogues for development of short peptides with improved cell selectivity. Functional analysis showed that two truncated peptides, Gj-CATH3-(38-42)-peptide and Gj-CATH3-(33-42)-peptide, exhibited excellent antioxidant activity against ABTS and DPPH free radicals. Further, cytotoxicity and hemolytic activities were observably lower compared to Gj-CATH3. Interestingly, both peptides also demonstrate significant wound healing properties in a mouse model with full-thickness skin wounds. The peptides induce HaCaT cell proliferation and prevent decreases in SOD activity and increases of MDA concentration in injured-skin tissue. This report is the first to address cathelicidin from reptilia that exhibit potent wound healing activity. Our research will enrich understanding of cathelicidin biological functions, and provide a theoretical basis for its clinical application.

Mechanism of action of antimicrobial peptide P5 truncations against Pseudomonas aeruginosa and Staphylococcus aureus.

Rates of microbial drug resistance are increasing worldwide; therefore, antimicrobial peptides (AMPs) are considered promising alternative therapeutic agents to antibiotics. AMPs are essential components of the innate immune system and exhibit broad-spectrum antimicrobial activity. P5 is a Cecropin A-Magainin 2 hybrid analog peptide with antimicrobial activity against Gram-negative and Gram-positive bacteria. In the present study, truncated peptides were designed to reduction length, retainment their antimicrobial activity and low toxicity at high concentrations compared with that of the parent peptide P5. The truncated peptides P5-CT1 and P5-NT1 exhibited antibacterial activities against both Gram-negative and Gram-positive bacteria. In contrast, P5-CT2, P5-CT3, P5-NT2, and P5-NT3 showed higher antibacterial activities against gram-positive bacteria compared to Gram-negative bacteria at low concentration of peptides. The truncated peptides showed lower hemolytic activity and toxic effects against mammalian cells compared with those of the parent peptide P5. The levels of several truncated peptides were maintained in the presence of physiological concentrations of salts, indicating their high stability. The results of flow cytometry, propidium iodide uptake, n-phenyl-1-naphthylamine uptake, and 3,3'-dipropylthiadicarbocyanine iodide assays showed that these truncated peptides killed microbial cells by increasing membrane permeability, thereby causing membrane damage. The results suggested that truncated peptides of P5 have good potential for use as novel antimicrobial agents.

TFP5 prevents 1-methyl-4-phenyl pyridine ion-induced neurotoxicity in mouse cortical neurons.

The present study aimed to investigate the protective effect of a modified p5 peptide, TFP5, on 1-methyl-4-phenyl pyridine ion (MPP+)-induced neurotoxicity in cortical neurons and explore the therapeutic effect of TFP5 on Parkinson's disease (PD). MPP+ was applied to a primary culture of mouse cortical neurons to establish the cell model of PD. Neurons were divided into four groups: Control, model (MPP+), scrambled peptide (Scb) (Scb + MPP+) and TFP5 (TFP5 + MPP+) groups. Pretreatment with Scb or TFP5 was applied to the latter two groups, respectively, for 3 h, while phosphate-buffered saline was applied to the control and model groups. MPP+ was then applied to all groups, with the exception of the control group, and neurons were cultured for an additional 24 h. Neuron viability was evaluated using a Cell Counting kit-8 (CCK8) assay. To explore the mechanism underlying the protective effects of TFP5, the expression levels of p35, p25 and phosphorylated myocyte enhancer factor 2 (p-MEF2D) were determined by western blotting. Fluorescence microscopy showed that TFP5 was able to pass through cell membranes and distribute around the nucleus. CCK8 assay showed that neuronal apoptosis was dependent on MPP+ concentration and exposure time. Cell viability decreased significantly in the model group compared with the control group (55±7 vs. 100±0%; P<0.01), and increased significantly in the TFP5 group compared with the model group (98±2 vs. 55±5%; P<0.01) and Scb group (98±2 vs. 54±4%; P<0.01). Scb exhibited no protective effect. Western blotting results showed that MPP+ induced p25 and p-MEF2D expression, TFP5 and Scb did not affect MPP+-induced p25 expression, but TFP5 reduced MPP+-induced p-MEF2D expression. In summary, TFP5 protects against MPP+-induced neurotoxicity in mouse cortical neurons, possibly through inhibiting the MPP+-induced formation and elevated kinase activity of a cyclin-dependent kinase 5/p25 complex.