RESUMO
BACKGROUND AND AIMS: Coronary artery disease (CAD), heart failure (HF), and ischemic heart disease (IHD) are three common cardiovascular diseases that are closely associated with metabolic activity. The global incidence and prevalence of these conditions are on the rise, primarily due to unhealthy lifestyles, aging populations, and the increasing prevalence of obesity and diabetes. Excessive screen time has emerged as a potential risk factor for various adverse health outcomes, although limited research has explored its relationship with cardiovascular disease outcomes. METHODS AND RESULTS: A Mendelian randomization (MR) study was conducted, employing exposure-associated genetic variants as instrumental variables to explore the causal relationship between screen time use and cardiovascular disease outcomes. Single nucleotide polymorphisms (SNPs) were utilized as pooled data for the genetic variable instrument, investigating the association between screen use duration and three types of cardiovascular diseases: coronary artery disease (CAD), heart failure (HF), and ischemic heart disease (IHD). Through the MR analysis, it was revealed that the use of mobile phones and TV screens exhibited a significant causal association with the occurrence of CAD, heart failure, and IHD. However, no significant association was observed between the use of computers and these three types of cardiovascular diseases. CONCLUSION: Our study suggests that excessive screen time use is associated with the development of cardiovascular disease. However, it should be noted that the consequences of screen time can vary depending on the reasons and purposes for its use. Implementing reasonable control over screen time, particularly for entertainment purposes, holds promise as a potential approach to mitigating cardiovascular disease.
Assuntos
Doenças Cardiovasculares , Doença da Artéria Coronariana , Insuficiência Cardíaca , Isquemia Miocárdica , Humanos , Doenças Cardiovasculares/diagnóstico , Doenças Cardiovasculares/epidemiologia , Doenças Cardiovasculares/genética , Doença da Artéria Coronariana/diagnóstico , Doença da Artéria Coronariana/epidemiologia , Doença da Artéria Coronariana/genética , Análise da Randomização Mendeliana/métodos , Tempo de Tela , Isquemia Miocárdica/diagnóstico , Isquemia Miocárdica/epidemiologia , Isquemia Miocárdica/genética , Insuficiência Cardíaca/diagnóstico , Insuficiência Cardíaca/epidemiologia , Insuficiência Cardíaca/genéticaRESUMO
BACKGROUND: The treatment of completely displaced midshaft clavicle fractures is still controversial, especially Robinson 2B fractures. Titanium elastic nail (TEN) fixation is a good option for simple fractures, but no reports exist on its use in complex fractures. This study aimed to present a surgical method using the Nice knot-assisted TEN fixation to treat Robinson 2B midshaft clavicular fractures. METHODS: A retrospective analysis of 29 patients who underwent fixation with TEN and had a 1-year postoperative follow-up between 2016 and 2020 was performed. The fractures were classified as Robinson type 2B1 in 17 cases and type 2B2 in 12 cases. Length of the incision, postoperative shoulder function Disability of Arm Shoulder and Hand (DASH) score and Constant score, complications rate, and second surgical incision length were recorded. RESULTS: The length of the incision was 2-6 cm (average 3.7 cm). All incisions healed by first intention, and no infection or nerve injury occurred. The Constant score was 92-100 (average 96) and the DASH score was 0-6.2 (mean, 2.64). TEN bending and hypertrophic nonunion occurred in one case (3.4%) and implant irritation occurred in four cases (13.8%) Fixation implants were removed at 12-26 months (mean, 14.6 months) after surgery, and the length of the second incision was 1-2.5 cm (average 1.3 cm). CONCLUSIONS: Intramedullary fixation by TEN is approved as a suitable surgical technique in clavicular fracture treatment. Nice knot-assisted fixation provides multifragmentary fracture stabilization, contributing to good fracture healing. Surgeons should consider this technique in treating Robinson 2B midshaft clavicular fractures. TRIAL REGISTRATION: Retrospectively registered. This study was approved by the Ethics Committee of Wuxi Ninth People's Hospital (LW20220021).
Assuntos
Fixação Intramedular de Fraturas , Fraturas Ósseas , Humanos , Titânio , Clavícula/diagnóstico por imagem , Clavícula/cirurgia , Clavícula/lesões , Estudos Retrospectivos , Resultado do Tratamento , Fraturas Ósseas/diagnóstico por imagem , Fraturas Ósseas/cirurgia , Consolidação da Fratura/fisiologia , Fixação Intramedular de Fraturas/métodos , Placas Ósseas , Fixação Interna de Fraturas/efeitos adversosRESUMO
BACKGROUND: MSM are at high risk of HIV infection. Previous studies have shown that the cell cycle regulation plays an important role in HIV-1 infection, especially at the G2/M checkpoint. ATR, Chk1, Cdc25C and CDK1 are key genes of G2/M checkpoint. However, the association between SNPs of these genes and susceptibility to HIV-1 infection and AIDS progression remains unknown. METHODS: In this study, 42 tSNPs from the above four G2/M checkpoint genes were genotyped in 529 MSM and 529 control subjects from northern China to analyze this association. RESULTS: The results showed that rs34660854 A and rs75368165 A in ATR gene and rs3756766 A in Cdc25C gene could increase the risk of HIV-1 infection (P = 0.049, OR = 1.234, 95% CI 1.001-1.521; P = 0.020, OR = 1.296, 95% CI 1.042-1.611; P = 0.011, OR = 1.392, 95% CI 1.080-1.794, respectively), while Chk1 rs10893405 (P = 0.029, OR = 1.629, 95% CI 1.051-2.523) were significantly associated with AIDS progression. Besides, rs34660854 (P = 0.019, OR = 1.364, 95% CI 1.052-1.769; P = 0.022, OR = 1.337, 95% CI 1.042-1.716, under Codominant model and Dominant model, respectively) and rs75368165 (P = 0.006, OR = 1.445, 95% CI = 1.114-1.899; P = 0.007, OR = 1.418, 95% CI 1.099-1.831, under Codominant model and Dominant model, respectively) in ATR gene, rs12576279 (P = 0.013, OR = 0.343, 95% CI 0.147-0.800; P = 0.048, OR = 0.437, 95% CI 0.192-0.991, under Codominant model and Dominant model, respectively) and rs540436 (P = 0.012, OR = 1.407, 95% CI 1.077-1.836; P = 0.021, OR = 1.359, 95% CI 1.048-1.762, under Codominant model and Dominant model, respectively) in Chk1 gene, rs3756766 (P = 0.013, OR = 1.455, 95% CI 1.083-1.954; P = 0.009, OR = 1.460, 95% CI 1.098-1.940, under Codominant model and Dominant model, respectively) in Cdc25C gene and rs139245206 (P = 0.022, OR = 5.011, 95% CI 1.267-19.816; P = 0.020, OR = 5.067, 95% CI 1.286-19.970, under Codominant model and Recessive model, respectively) in CDK1 gene were significantly associated with HIV-1 infection under different models. CONCLUSIONS: We found that genetic variants of G2/M checkpoint genes had a molecular influence on the occurrence of HIV-1 infection and AIDS progression in a northern Chinese MSM population.
Assuntos
Síndrome da Imunodeficiência Adquirida , Pontos de Checagem do Ciclo Celular , Infecções por HIV , Minorias Sexuais e de Gênero , Humanos , Masculino , Síndrome da Imunodeficiência Adquirida/epidemiologia , Síndrome da Imunodeficiência Adquirida/genética , População do Leste Asiático , Infecções por HIV/epidemiologia , Infecções por HIV/genética , HIV-1 , Homossexualidade Masculina , Pontos de Checagem do Ciclo Celular/genéticaRESUMO
PURPOSE: To evaluate the feasibility and clinical effect of Krackow suturing combined with the suture bridge technique for the treatment of acute inferior pole patella fracture. METHODS: In this study, 18 patients with acute inferior pole patella fracture who received treatment using Krackow suturing combined with the suture bridge technique between January 2019 and March 2020 were retrospectively reviewed. There were 10 men and 8 women, with an average age of 50.1 years (range 24-69 years). X-ray examinations were performed to assess fracture healing and the Insall-Salvati index. The clinical effect was measured by the range of motion of the knee joint and the Böstman scale. RESULTS: Patients were followed up for 13-26 months, with an average follow-up period of 19.6 months. X-ray indicated that fracture union had occurred in all patients by 10.1 weeks after surgery on average (range 8-14 weeks). The mean Insall-Salvati index immediately after surgery and at the final follow-up was 0.98 ± 0.07 and 0.90 ± 0.22, respectively (P > 0.05). At the last follow-up, the mean flexion and extension ranges for the knee joint were 135.8° ± 8.8° and - 2.8° ± 3.9°, respectively, and the mean Böstman scale was 28.9 ± 1.1 points. Functional recovery was excellent in 17 patients and good in one patient, resulting in an overall good/excellent recovery rate of 100%. CONCLUSIONS: Our results indicated that Krackow suturing combined with the suture bridge technique can achieve stable fracture fixation, provides good clinical outcomes in the treatment of acute inferior pole patella fracture, and is worthy of clinical application.
Assuntos
Fraturas Ósseas , Traumatismos do Joelho , Fratura da Patela , Masculino , Humanos , Feminino , Adulto Jovem , Adulto , Pessoa de Meia-Idade , Idoso , Fixação Interna de Fraturas/métodos , Estudos Retrospectivos , Fios Ortopédicos , Patela/cirurgia , Fraturas Ósseas/diagnóstico por imagem , Fraturas Ósseas/cirurgia , Suturas , Traumatismos do Joelho/cirurgia , Resultado do TratamentoRESUMO
BACKGROUND: Most susceptible loci of hepatocellular carcinoma (HCC) identified by genome-wide association studies (GWAS) are located in non-coding regions, and the mechanism of action remains unclear. The objective of this study was to explore the association of single nucleotide polymorphisms (SNPs) on long non-coding RNAs (lncRNAs) that affect competing endogenous RNAs (ceRNA) regulation mechanism with the risk and prognosis of HCC. METHODS: Based on a set of bioinformatics strategies, eight lncRNA genes that affect HCC through the mechanism of lncRNA-mediated ceRNA were systematically screened, and 15 SNPs that affect microRNA (miRNA) binding in these lncRNA genes were annotated. Genotyping was performed in 800 HCC cases and 801 healthy controls to examine associations of these SNPs with HCC in a northeastern Chinese Han population. RESULTS: The GG, GC and GG + GC genotypes of HOTAIR rs7958904 were associated with a 0.65, 0.59 and 0.63-fold decreased HCC risk, respectively. In addition, HCC patients with PVT1 rs3931282 AA + GA genotypes were less prone to develop late-stage cancers in a stratified analysis of clinical characteristics. When stratified by clinical biochemical indexes, rs1134492 and rs10589312 in PVT1 and rs84557 in EGFR-AS1 showed significant associations with aspartate aminotransferase (AST), alanine aminotransferase (ALT) or AST/ALT ratio in HCC patients. Furthermore, we constructed potential ceRNA regulatory axes that might be affected by five positive SNPs to explain the causes of these genetic associations. CONCLUSIONS: HOTAIR rs7958904, PVT1 rs3931282, rs1134492 and rs10589312, and EGFR-AS1 rs84557 might be predictors for HCC risk or prognosis. Our results provide new insights into how SNPs on lncRNA-mediated ceRNAs confer interindividual differences to occurrence and progression of HCC.
Assuntos
Carcinoma Hepatocelular , Neoplasias Hepáticas , RNA Longo não Codificante , Humanos , RNA Longo não Codificante/genética , Carcinoma Hepatocelular/genética , Polimorfismo de Nucleotídeo Único , Estudo de Associação Genômica Ampla , Neoplasias Hepáticas/genética , Prognóstico , Receptores ErbBRESUMO
OBJECTIVES: The relationship between Noggin (NOG) and methylenetetrahydrofolate reductase and nonsyndromic cleft lip and palate (NSCLP) has been reported participate in craniofacial development but need further evidence. To indicate the susceptibility between the 2 genes and NSCLP, rs227731 and rs1801131 polymorphisms were included in the present research. This research may provide some genetic clues for disease detection and surveillance. DESIGN: Seventeen studies including 4023 cases and 5691 controls were provided for meta-analysis, and odds ratio (OR) with 95% CI were obtained to estimate NSCLP risk. RESULTS: Our analysis suggested potential association of rs227731C on increasing the risk of NSCLP in the Caucasian group and total group but not Asian group under all models: allele (OR = 1.45, 95% CI = 1.21-1.75, P < .0001), homozygote (OR = 2.03, 95% CI = 1.42-2.90, P < .0001), heterozygote (OR = 1.44, 95% CI = 1.19-1.73, P = .0001), dominant (OR = 1.61, 95% CI = 1.27-2.04, P < .0001), and recessive models (OR = 1.63, 95% CI = 1.25-2.12, P = .0003). Besides, increased risk is related to rs1801131 in Asian group under 3 models: allele (OR = 1.24, 95% CI = 1.06-1.44, P = .006), heterozygote (OR = 1.24, 95% CI = 1.02-1.52, P = .03), and dominant models (OR = 1.29, 95% CI = 1.06-1.56, P = .009). CONCLUSIONS: Our analysis indicates polymorphisms rs227731 and rs1801131 are associated with NSCLP, with predominance of different ethnic group and deepen understanding of NSCLP.
Assuntos
Fenda Labial , Fissura Palatina , Estudos de Casos e Controles , Fenda Labial/genética , Fissura Palatina/genética , Predisposição Genética para Doença , Humanos , Polimorfismo de Nucleotídeo ÚnicoRESUMO
Glioblastoma (GBM) is the most common primary intracranial tumor with extremely high malignancy and poor prognosis. In order to identify the GBM prognostic biomarkers and establish a prognostic model, we analyzed the expression profile data of GBM in The Cancer Genome Atlas (TCGA) database as the experimental group. First, we identified the differentially expressed genes of different survival periods among the GBM patients. The GISTIC software and Kaplan Meier (KM) survival curve were used to analyze the copy number variation of GBM to identify the survival-associated amplified gene (SAG). We selected the intersection genes of up-regulated ones in short survival group and SAG, performed univariate Cox regression and iterative Lasso regression with them to identify the important candidate genes and establish a prognostic model. Based on the model, the prognostic score was calculated. The patients were divided into high-risk and low-risk groups according to the median prognostic score. Meanwhile ROC curve was used to evaluate the validity of the model, applying the KM survival analysis of the high-risk and low-risk groups. Multivariate Cox regression analysis was used to determine the independence of the prognostic score. All the data were verified with three external datasets: GEO GSE16011, CGGA, and Rembrandt. The results showed that differential expression analysis of different survival periods of GBM identified 426 up-regulated genes and 65 down-regulated genes in the TCGA GBM dataset. The intersection of up-regulated genes in short survival group and SAG yielded 47 genes. After the screening, the six-gene combination (EN2,PPBP,LRRC61,SEL1L3,CPA4,DDIT4L) prognostic model was finally determined. The area under ROC curve of the model in TCGA experimental group and three external validation group were all greater than 0.6, even reaching 0.912. KM analysis showed that the prognosis of the high-risk and low-risk groups was significant different (P<0.05). In the multivariate Cox regression analysis, the six-gene prognostic score was an independent factor influencing the prognosis of GBM patients (P<0.05). In summary, this study established a prognostic model of six-gene (EN2,PPBP,LRRC61,SEL1L3,CPA4,DDIT4L) for GBM. This six-gene model has good predictive ability and could be used as an independent prognostic marker for GBM patients.
Assuntos
Neoplasias Encefálicas , Glioblastoma , Proteínas Adaptadoras de Transdução de Sinal , Neoplasias Encefálicas/genética , Variações do Número de Cópias de DNA , Regulação Neoplásica da Expressão Gênica , Glioblastoma/genética , Humanos , PrognósticoRESUMO
Gene amplification chiefly manifests as homogeneously stained regions (HSRs) or double minutes (DMs) in cytogenetically and extrachromosomal DNA (ecDNA) in molecular genetics. Evidence suggests that gene amplification is becoming a hotspot for cancer research, which may be a new treatment strategy for cancer. DMs usually carry oncogenes or chemoresistant genes that are associated with cancer progression, occurrence and prognosis. Defining the molecular structure of DMs will facilitate understanding of the molecular mechanism of tumorigenesis. In this study, we re-identified the origin and integral sequence of DMs in human colorectal adenocarcinoma cell line NCI-H716 by genetic mapping and sequencing strategy, employing high-resolution array-based comparative genomic hybridization, high-throughput sequencing, multiplex-fluorescence in situ hybridization and chromosome walking techniques. We identified two distinct populations of DMs in NCI-H716, confirming their heterogeneity in cancer cells, and managed to construct their molecular structure, which were not investigated before. Research evidence of amplicons distribution in two different populations of DMs suggested that a multi-step evolutionary model could fit the module of DM genesis better in NCI-H716 cell line. In conclusion, our data implicated that DMs play a very important role in cancer progression and further investigation is necessary to uncover the role of the DMs.
Assuntos
Neoplasias Colorretais/genética , Evolução Molecular , Amplificação de Genes , Sequência de Bases , Linhagem Celular Tumoral , Aberrações Cromossômicas , Pontos de Quebra do Cromossomo , Passeio de Cromossomo , Cromossomos Humanos Par 10 , Cromossomos Humanos Par 8 , Neoplasias Colorretais/patologia , Hibridização Genômica Comparativa , Análise Citogenética/métodos , Humanos , Hibridização in Situ FluorescenteRESUMO
BACKGROUND: Previous studies reported that DNA damage repair (DDR) genes may play an important role in HIV-1 infection. The MRE11 gene, a member of the MRN complex, plays an essential part in the homologous recombination pathway, which is one of the classical DDR pathways. Previous reports have demonstrated that MRE11 has an effect on HIV-1 replication. However, the role of SNPs in the MRE11 gene and their impact on HIV-1 infection and AIDS progression remain unknown. METHODS: In this study, 434 MSM HIV-1-infected patients in northern China and 431 age-matched healthy controls were enrolled. Five SNPs (rs2155209, rs10831234, rs13447720, rs601341 and rs11020803) at the MRE11 gene were genotyped. Another series of cases (409 MSM HIV-1-infected patients) and controls (403 age-matched healthy males) were recruited as the validation set. RESULTS: In our study, rs10831234 showed differences in allele frequencies between cases and controls (Pâ=â0.005). Additionally, there was an association between rs10831234 and HIV-1 infection susceptibility in dominant and additive models (Pâ=â0.005 and Pâ=â0.006, respectively). All significant associations were replicated in the validation set, and the associations were still significant after Bonferroni correction for multiple testing when the two data sets were combined. Furthermore, in haplotype association analyses between the case and control groups, the frequencies of the haplotypes Crs11020803Crs10831234 and Trs11020803Trs10831234 showed significant differences (Pâ=â0.0181 and Pâ=â0.0068, respectively). CONCLUSIONS: We demonstrated that the MRE11 rs10831234-T allele may confer increased risk of HIV-1 infection.
Assuntos
Predisposição Genética para Doença , Infecções por HIV/genética , Infecções por HIV/virologia , HIV-1/fisiologia , Homossexualidade Masculina , Proteína Homóloga a MRE11/genética , Polimorfismo de Nucleotídeo Único , Síndrome da Imunodeficiência Adquirida/epidemiologia , Síndrome da Imunodeficiência Adquirida/genética , Síndrome da Imunodeficiência Adquirida/virologia , Adolescente , Adulto , Idoso , Idoso de 80 Anos ou mais , Alelos , Estudos de Casos e Controles , China/epidemiologia , Frequência do Gene , Genótipo , Infecções por HIV/epidemiologia , Infecções por HIV/imunologia , Haplótipos , Humanos , Desequilíbrio de Ligação , Masculino , Pessoa de Meia-Idade , Razão de Chances , Carga Viral , Adulto JovemRESUMO
BACKGROUND: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.
Assuntos
Duplicação Gênica , Heterozigoto , Proteínas de Homeodomínio/genética , Mutação , Sindactilia/genética , Fatores de Transcrição/genética , Criança , China , Éxons , Feminino , Humanos , Masculino , LinhagemRESUMO
BACKGROUND: Heilongjiang Province located in northeast China is a multi-ethnic region with people who have lived in cold conditions for several generations. Fatty acids are important to people with cold resistance. CPT1A encodes a protein that imports long-chain fatty acids into the mitochondria for fatty-acid oxidation. FADS is an essential enzyme for the synthesis of long-chain polyunsaturated fatty acids. RESULTS: In the present study, we investigated the distributions of three cold resistance-related SNPs (rs80356779 G > A in CPT1A, rs7115739 T > G in FADS3 and rs174570 C > T in FADS2) from six populations that included 1093 individuals who have lived in Heilongjiang Province for at least three generations. The frequencies of rs174570 and rs7115739 were different in our six north minorities compared to the Chinese Dai in Xishuangbanna (CDX) in southern China. All the SNPs in Hezhen were significantly different from other five studied populations. In addition, the genetic distribution of rs174570 in Daur was significantly different from Manchu and Korea, and the frequency of rs7115739 in Ewenki was significantly different from the other populations. The results also showed that the frequencies of the three SNPs in the six minorities were different from those of Greenlandic Inuit and Siberian population. CONCLUSIONS: Our results showed the distributions of the three cold resistance-related SNPs from six populations that included 1093 individuals in northern China. Distributions of the allele frequencies for the cold resistance-related SNPs in northern China were statistically different from those in southern China. These data help to establish the DNA genome database for the six populations and fully preserve existing minority genetic information.
Assuntos
Adaptação Fisiológica/genética , Temperatura Baixa , Etnicidade/genética , Polimorfismo de Nucleotídeo Único , Povo Asiático/genética , Carnitina O-Palmitoiltransferase/genética , China , Etnicidade/classificação , Ácidos Graxos Dessaturases/genética , Frequência do Gene , Genótipo , Humanos , Desequilíbrio de Ligação , FilogeniaRESUMO
Men who have sex with men (MSM) are at high risk of HIV infection. The APOBEC3G (apolipoprotein B mRNA editing catalytic polypeptide 3G) protein is a component of innate antiviral immunity that inhibits HIV-1 replication. In the present study, a total of 483 HIV-1 seropositive men and 493 HIV-1 seronegative men were selected to investigate the association between single nucleotide polymorphisms (SNPs) of the APOBEC3G gene and susceptibility to HIV-1 infection and AIDS progression among MSM residing in northern China. Genotyping of four SNPs (rs5757465, rs3736685, rs8177832, and rs2899313) of the APOBEC3G was performed using the SNPscan™ Kit, while the rs2294367 polymorphism was genotyped using the SNaPshot multiplex system. Our results disclosed no association between the SNPs of APOBEC3G and susceptibility to HIV-1, or effects of these polymorphisms on the CD4+ T cell count or clinical phase of disease. A meta-analysis of 1624 men with HIV-1 infection and 1523 controls suggested that the association between rs8177832 and susceptibility was not significant. However, we observed a trend towards association with HIV-1 infection for haplotype TTACA (p = 0.082). The potential role of variants of APOBEC3G in HIV-1/AIDS warrants further investigation.
Assuntos
Desaminase APOBEC-3G/genética , Predisposição Genética para Doença , Infecções por HIV/genética , Polimorfismo de Nucleotídeo Único , Adolescente , Adulto , Idoso , Contagem de Linfócito CD4 , China , Progressão da Doença , Técnicas de Genotipagem , Infecções por HIV/imunologia , Infecções por HIV/patologia , Homossexualidade Masculina , Humanos , Masculino , Pessoa de Meia-Idade , Adulto JovemRESUMO
Double minute chromosomes (DMs) are extrachromosomal cytogenetic structures found in tumour cells. As hallmarks of gene amplification, DMs often carry oncogenes and drug-resistance genes and play important roles in malignant tumour progression and drug resistance. The mitogen-activated protein kinase (MAPK) signalling pathway is frequently dysregulated in human malignant tumours, which induces genomic instability, but it remains unclear whether a close relationship exists between MAPK signalling and DMs. In the present study, we focused on three major components of MAPK signalling, ERK1/2, JNK1/2/3 and p38, to investigate the relationship between MAPK and DM production in tumour cells. We found that the constitutive phosphorylation of ERK1/2, but not JNK1/2/3 and p38, was closely associated with DMs in tumour cells. Inhibition of ERK1/2 activation in DM-containing and ERK1/2 constitutively phosphorylated tumour cells was able to markedly decrease the number of DMs, as well as the degree of amplification and expression of DM-carried genes. The mechanism was found to be an increasing tendency of DM DNA to break, become enveloped into micronuclei (MNs) and excluded from the tumour cells during the S/G2 phases of the cell cycle, events that accompanied the reversion of malignant behaviour. Our study reveals a linkage between ERK1/2 activation and DM stability in tumour cells.
Assuntos
Ciclo Celular/genética , Cromossomos Humanos/genética , Sistema de Sinalização das MAP Quinases/genética , Proteína Quinase 1 Ativada por Mitógeno/metabolismo , Proteína Quinase 3 Ativada por Mitógeno/metabolismo , Neoplasias/metabolismo , Transdução de Sinais/genética , Linhagem Celular Tumoral , Núcleo Celular/genética , Ativação Enzimática , Feminino , Amplificação de Genes/genética , Humanos , FosforilaçãoRESUMO
BACKGROUND: Gene amplification is a frequent manifestation of genomic instability that plays a role in tumour progression and development of drug resistance. It is manifested cytogenetically as extrachromosomal double minutes (DMs) or intrachromosomal homogeneously staining regions (HSRs). To better understand the molecular mechanism by which HSRs and DMs are formed and how they relate to the development of methotrexate (MTX) resistance, we used two model systems of MTX-resistant HT-29 colon cancer cell lines harbouring amplified DHFR primarily in (i) HSRs and (ii) DMs. RESULTS: In DM-containing cells, we found increased expression of non-homologous end joining (NHEJ) proteins. Depletion or inhibition of DNA-PKcs, a key NHEJ protein, caused decreased DHFR amplification, disappearance of DMs, increased formation of micronuclei or nuclear buds, which correlated with the elimination of DHFR, and increased sensitivity to MTX. These findings indicate for the first time that NHEJ plays a specific role in DM formation, and that increased MTX sensitivity of DM-containing cells depleted of DNA-PKcs results from DHFR elimination. Conversely, in HSR-containing cells, we found no significant change in the expression of NHEJ proteins. Depletion of DNA-PKcs had no effect on DHFR amplification and resulted in only a modest increase in sensitivity to MTX. Interestingly, both DM-containing and HSR-containing cells exhibited decreased proliferation upon DNA-PKcs depletion. CONCLUSIONS: We demonstrate a novel specific role for NHEJ in the formation of DMs, but not HSRs, in MTX-resistant cells, and that NHEJ may be targeted for the treatment of MTX-resistant colon cancer.
Assuntos
Neoplasias do Colo/tratamento farmacológico , Neoplasias do Colo/genética , Reparo do DNA por Junção de Extremidades/genética , Resistencia a Medicamentos Antineoplásicos/genética , Metotrexato/farmacologia , Metotrexato/uso terapêutico , Proliferação de Células/efeitos dos fármacos , Neoplasias do Colo/patologia , Quebras de DNA de Cadeia Dupla/efeitos dos fármacos , Resistencia a Medicamentos Antineoplásicos/efeitos dos fármacos , Amplificação de Genes/efeitos dos fármacos , Células HT29 , Humanos , Coloração e RotulagemRESUMO
Copy number variations (CNVs) in the human genome contribute significantly to disease. De novo CNV mutations arise via genomic rearrangements, which can occur in 'trans', i.e. via interchromosomal events, or in 'cis', i.e. via intrachromosomal events. However, what molecular mechanisms occur between chromosomes versus between or within chromatids has not been systematically investigated. We hypothesized that distinct CNV mutational mechanisms, based on their intrinsic properties, may occur in a biased intrachromosomal versus interchromosomal manner. Here, we studied 62 genomic duplications observed in association with sporadic Potocki-Lupski syndrome (PTLS), in which multiple mutational mechanisms appear to be operative. Intriguingly, more interchromosomal than intrachromosomal events were identified in recurrent PTLS duplications mediated by non-allelic homologous recombination, whereas the reciprocal distribution was found for replicative mechanisms and non-homologous end-joining, likely reflecting the differences in spacial proximity of homologous chromosomes during different mutational processes.
Assuntos
Cromossomos Humanos Par 17 , Variações do Número de Cópias de DNA , Replicação do DNA , Síndrome de Smith-Magenis/genética , Anormalidades Múltiplas , Transtornos Cromossômicos , Duplicação Cromossômica , Hibridização Genômica Comparativa , Reparo do DNA por Junção de Extremidades , Duplicação Gênica , Humanos , Linhagem , Polimorfismo de Nucleotídeo Único , Análise de Sequência de DNARESUMO
Double minute chromosomes (DMs) are a hallmark of gene amplification. The relationship between the formation of DMs and the amplification of DM-carried genes remains to be clarified. The human colorectal cancer cell line NCI-H716 and human malignant primitive neuroectodermal tumor cell line SK-PN-DW are known to contain many DMs. To examine the amplification of DM-carried genes in tumor cells, we performed Affymetrix SNP Array 6.0 analyses and verified the regions of amplification in NCI-H716 and SK-PN-DW tumor cells. We identified the amplification regions and the DM-carried genes that were amplified and overexpressed in tumor cells. Using RNA interference, we downregulated seven DM-carried genes, (NDUFB9, MTSS1, NSMCE2, TRIB1, FAM84B, MYC and FGFR2) individually and then investigated the formation of DMs, the amplification of the DM-carried genes, DNA damage and the physiological function of these genes. We found that suppressing the expression of DM-carried genes led to a decrease in the number of DMs and reduced the amplification of the DM-carried genes through the micronuclei expulsion of DMs from the tumor cells. We further detected an increase in the number of γH2AX foci in the knockdown cells, which provides a strong link between DNA damage and the loss of DMs. In addition, the loss of DMs and the reduced amplification and expression of the DM-carried genes resulted in a decrease in cell proliferation and invasion ability.
Assuntos
Biomarcadores Tumorais/genética , Cromossomos Humanos/genética , Neoplasias Colorretais/patologia , Amplificação de Genes , Micronúcleos com Defeito Cromossômico , Tumores Neuroectodérmicos Primitivos/patologia , Polimorfismo de Nucleotídeo Único/genética , Biomarcadores Tumorais/metabolismo , Western Blotting , Ciclo Celular , Movimento Celular , Núcleo Celular/genética , Proliferação de Células , Neoplasias Colorretais/genética , Neoplasias Colorretais/metabolismo , Dano ao DNA/genética , Imunofluorescência , Perfilação da Expressão Gênica , Histonas/genética , Histonas/metabolismo , Humanos , Tumores Neuroectodérmicos Primitivos/genética , Tumores Neuroectodérmicos Primitivos/metabolismo , Análise de Sequência com Séries de Oligonucleotídeos , RNA Mensageiro/genética , Reação em Cadeia da Polimerase em Tempo Real , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Células Tumorais CultivadasRESUMO
OBJECTIVE: This study aimed to investigate the potential causal relationship between screen time and the risk of developing type 2 diabetes mellitus (T2DM) using Mendelian randomization. METHODS: Two-sample Mendelian randomization was conducted, utilizing genetic variants associated with different types of screen time as instrumental variables. Single nucleotide polymorphisms (SNPs) were used to assess the primary outcome, which was the risk of developing T2DM. RESULTS: The analysis revealed a significant positive causal association between television viewing time and the risk of T2DM. Specifically, excessive television viewing time was found to increase the risk of developing T2DM (OR: 2.39, 95% CI: 1.90 to 3.00, P < 0.01). However, no significant causal relationship was observed between computer usage time and the risk of T2DM. Additionally, mobile phone use time showed a positive correlation with the risk of T2DM (OR: 1.31, 95% CI: 1.04 to 1.64, P = 0.02), albeit to a lesser extent than television viewing time. CONCLUSION: The findings of this study indicate a significant causal association between certain types of screen time, specifically television viewing and mobile phone use, and an increased risk of T2DM.
RESUMO
BACKGROUND: Stomach cancer is a leading cause of cancer-related deaths globally due to its high grade and poor response to treatment. Understanding the molecular network driving the rapid progression of stomach cancer is crucial for improving patient outcomes. METHODS: This study aimed to investigate the role of unfolded protein response (UPR) related genes in stomach cancer and their potential as prognostic biomarkers. RNA expression data and clinical follow-up information were obtained from the TCGA and GEO databases. An unsupervised clustering algorithm was used to identify UPR genomic subtypes in stomach cancer. Functional enrichment analysis, immune landscape analysis, and chemotherapy benefit prediction were conducted for each subtype. A prognostic model based on UPR-related genes was developed and validated using LASSO-Cox regression, and a multivariate nomogram was created. Key gene expression analyses in pan-cancer and in vitro experiments were performed to further investigate the role of the identified genes in cancer progression. RESULTS: A total of 375 stomach cancer patients were included in this study. Analysis of 113 UPR-related genes revealed their close functional correlation and significant enrichment in protein modification, transport, and RNA degradation pathways. Unsupervised clustering identified two molecular subtypes with significant differences in prognosis and gene expression profiles. Immune landscape analysis showed that UPR may influence the composition of the tumor immune microenvironment. Chemotherapy sensitivity analysis indicated that patients in the C2 molecular subtype were more responsive to chemotherapy compared to those in the C1 molecular subtype. A prognostic signature consisting of seven UPR-related genes was constructed and validated, and an independent prognostic nomogram was developed. The gene IGFBP1, which had the highest weight coefficient in the prognostic signature, was found to promote the malignant phenotype of stomach cancer cells, suggesting its potential as a therapeutic target. CONCLUSIONS: The study developed a UPR-related gene classifier and risk signature for predicting survival in stomach cancer, identifying IGFBP1 as a key factor promoting the disease's malignancy and a potential therapeutic target. IGFBP1's role in enhancing cancer cell adaptation to endoplasmic reticulum stress suggests its importance in stomach cancer prognosis and treatment.
Assuntos
Biomarcadores Tumorais , Neoplasias Gástricas , Microambiente Tumoral , Resposta a Proteínas não Dobradas , Neoplasias Gástricas/genética , Neoplasias Gástricas/imunologia , Neoplasias Gástricas/mortalidade , Neoplasias Gástricas/patologia , Humanos , Microambiente Tumoral/imunologia , Microambiente Tumoral/genética , Resposta a Proteínas não Dobradas/genética , Resposta a Proteínas não Dobradas/imunologia , Prognóstico , Biomarcadores Tumorais/genética , Biomarcadores Tumorais/metabolismo , Regulação Neoplásica da Expressão Gênica , Feminino , Masculino , Nomogramas , Transcriptoma , Perfilação da Expressão Gênica , Pessoa de Meia-IdadeRESUMO
BACKGROUND: The treatment of bone and soft-tissue defects after open fractures remains challenging. This study aimed to evaluate the clinical efficacy of the Masquelet technique combined with the free-flap technique (MFFT) versus the Ilizarov bone transport technique (IBTT) for the treatment of severe composite tibial and soft-tissue defects. METHODS: We retrospectively analysed the data of 65 patients with tibial and soft-tissue defects and Gustilo type IIIB/C open fractures treated at our hospital between April 2015 and December 2021. The patients were divided into two groups based on the treatment method: group A (n = 35) was treated with the MFFT and internal fixation, and group B (n = 30) was treated with the IBTT. RESULTS: The mean follow-up period was 28 months (range 13-133 months). Complete union of both soft-tissue and bone defects was achieved in all cases. The mean bone-union times were 6 months (range 3-12 months) in group A and 11 months (range 6-23 month) in group B, with a significant difference between the two groups (Z = -4.11, P = 0.001). The mean hospital stay was 28 days (range 14-67 d) in group A which was significantly longer than the mean stay of 18 days (range 10-43 d) in group B (Z = -2.608, P = 0.009). There were no significant differences in the infection rate between group A (17.1 %) and group B (26.7%) (χ2 = 0.867, P = 0.352). The Total Physical Health Scores were 81.51 ± 6.86 (range 67-90) in group A and 75.83±16.14 (range 44-98) in group B, with no significant difference between the two groups (t = 1.894, P = 0.063). The Total Mental Health Scores were significantly higher in group A (90.49 ± 6.37; range 78-98) than in group B (84.70 ± 13.72; range 60-98) (t = 2.232, P = 0.029). CONCLUSION: Compared with IBTT, MFFT is a better choice of treatment for open tibial and soft-tissue defects with Gustilo IIIB/C fractures. IBTT is the preferred option when the tibial bone defect is large or if the surgeon's expertise in microsurgery is limited.
Assuntos
Fixação Interna de Fraturas , Fraturas Expostas , Retalhos de Tecido Biológico , Técnica de Ilizarov , Lesões dos Tecidos Moles , Fraturas da Tíbia , Humanos , Masculino , Lesões dos Tecidos Moles/cirurgia , Feminino , Estudos Retrospectivos , Fraturas Expostas/cirurgia , Adulto , Pessoa de Meia-Idade , Fraturas da Tíbia/cirurgia , Resultado do Tratamento , Fixação Interna de Fraturas/métodos , Procedimentos de Cirurgia Plástica/métodos , Consolidação da Fratura , Idoso , Adulto Jovem , Transplante Ósseo/métodos , Adolescente , Desbridamento/métodosRESUMO
Objective: To explore the effectiveness of using antibiotic bone cement-coated plates internal fixation technology as a primary treatment for Gustilo type â ¢B tibiofibular open fractures. Methods: The clinical data of 24 patients with Gustilo type â ¢B tibiofibular open fractures who were admitted between January 2018 and December 2021 and met the selection criteria was retrospectively analyzed. Among them, there were 18 males and 6 females, aged from 25 to 65 years with an average age of 45.8 years. There were 3 cases of proximal tibial fracture, 6 cases of middle tibial fracture, 15 cases of distal tibial fracture, and 21 cases of fibular fracture. The time from injury to emergency surgery ranged from 3 to 12 hours, with an average of 5.3 hours. All patients had soft tissue defects ranging from 10 cm×5 cm to 32 cm×15 cm. The time from injury to skin flap transplantation for wound coverage ranged from 1 to 7 days, with an average of 4.1 days, and the size of skin flap ranged from 10 cm×5 cm to 33 cm×15 cm. Ten patients had bone defects with length of 2-12 cm (mean, 7.1 cm). After emergency debridement, the tibial fracture end was fixed with antibiotic bone cement-coated plates, and the bone defect area was filled with antibiotic bone cement. Within 7 days, the wound was covered with a free flap, and the bone cement was replaced while performing definitive internal fixation of the fracture. In 10 patients with bone defect, all the bone cement was removed and the bone defect area was grafted after 7-32 weeks (mean, 11.8 weeks). The flap survival, wound healing of the affected limb, complications, and bone healing were observed after operation, and the quality of life was evaluated according to the short-form 36 health survey scale (SF-36 scale) [including physical component summary (PCS) and mental component summary (MCS) scores] at 1 month, 6 months after operation, and at last follow-up. Results: All 24 patients were followed up 14-38 months (mean, 21.6 months). All the affected limbs were successfully salvaged and all the transplanted flaps survived. One case had scar hyperplasia in the flap donor site, and 1 case had hypoesthesia (grade S3) of the skin around the scar. There were 2 cases of infection in the recipient area of the leg, one of which was superficial infection after primary flap transplantation and healed after debridement, and the other was sinus formation after secondary bone grafting and was debrided again 3 months later and treated with Ilizarov osteotomy, and healed 8 months later. The bone healing time of the remaining 23 patients ranged from 4 to 9 months, with an average of 6.1 months. The scores of PCS were 44.4±6.5, 68.3±8.3, 80.4±6.9, and the scores of MCS were 59.2±8.2, 79.5±7.8, 90.0±6.6 at 1 month, 6 months after operation, and at last follow-up, respectively. The differences were significant between different time points ( P<0.05). Conclusion: Antibiotic bone cement-coated plates internal fixation can be used in the primary treatment of Gustilo type â ¢B tibiofibular open fractures, and has the advantages of reduce the risk of infection in fracture fixation, reducing complications, and accelerating the functional recovery of patients.