First report of Tomato yellow mottle-associated virus infecting pepper (Capsicum annuum L.) in China.

Tomato yellow mottle-associated virus (TYMaV), is a member of the genus Cytorhabdovirus in the family Rhabdoviridae, which has been reported to infect tomato (Lycopersicon esculentum) (Xu et al. 2017), Solanum nigrum (Li et al., 2022) and Nicotiana benthamiana (Zhou et al. 2019). In July 2021, virus-like symptoms of chlorosis, mosaic, and ring spots were observed in pepper, tomato, and eggplant during a survey of viral symptoms in Huzhou City, Zhejiang Province, China. To identify viral agents potentially associated with these diseases, an Oxford Nanopore cDNA library from the mixed samples was generated and sequenced. Briefly, total RNA from 10 leaf tissue samples (3 pepper plants, 4 tomato plants, and 3 eggplant plants) was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and pooled in equal amounts (100 ng/l each). The library was constructed using a PCR-cDNA sequencing kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK) in accordance with the manufacturer's instructions. Approximately 8.6 million reads were obtained from the Oxford MinION platform. After removing adapters and low-quality reads using iVar v1.3.1 (Grubaugh et al., 2019), the clean reads were subjected to BLASTn search in the GenBank database. We identified sequences derived from potato virus X (PVX), potato virus Y (PVY), cucumber mosaic virus (CMV), pepper mottle virus (PepMoV), and TYMaV. Of these reads, 339 with lengths ranging from 375 to 8651 nt were mapped to the genome of TYMaV (GeneBank Accession No. KY075646.1) at a 98.2% query coverage. To identify TYMaV-infected plants in the pooled samples, all 10 samples were analyzed by two-step RT-PCR using AMV reverse transcriptase (Takara, Tokyo, Japan) combined with random primers N6 (Takara, Dalian, China) and high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan) with primer pairs: N-F 5'- CAGGGAGAGAATGTACAAGTTGATC'/N-R 5'- GACCTTGCTCATCTGATGCAAC -3', amplifying 420 bp of the 3'end of nucleoprotein (N) gene. A pepper sample showing chlorosis symptom was positive for the TYMaV infection, but negative for PVX, PVY, CMV or PepMoV infection when tested using the primers listed in table S1. To confirm the genome sequence of TYMaV Zhejiang isolate (TYMaV-ZJ), we carried out two-step RT-PCR with seven primer pairs (Table S1) designed based on the reference TYMaV genome (GeneBank accession number KY075646.1). PCR products were cloned into pLB vector (Tiangen, Beijing, China) and Sanger sequenced in both directions. At least five independent clones of each fragment were sequenced to avoid possible mutations introduced by PCT. The sequences were assembled into a nearlyfull-length genome of TYMaV -ZJ which was composed of 13344nt (GeneBank accession number OP296980). Pairwise sequence comparison revealed that TYMaV -ZJ genome shared 91.50% and 85.59% nt sequence identity with that of the TYMaV tomato isolate (KY075646.1) and the Solanum nigrum isolate (MW527091.1), which is higher than the species demarcation threshold of 75% for the genus Cytorhabdovirus (Walker et al., 2022). To the best of our knowledge, this is the first report of TYMaV infecting pepper.

Cuproptosis-related gene ATOX1 promotes MAPK signaling and diffuse large B-cell lymphoma proliferation via modulating copper transport.

Diffuse Large B-cell lymphoma (DLBCL) is a common subtype of non-Hodgkin lymphoma, highlighting the importance of studying susceptibility genes to develop personalized treatment strategies. While cuproptosis, caused by high levels of copper ions induced by ionophores, has been shown to affect cancer survival, its specific role in lymphoma is not yet clear. To investigate the involvement of upregulation-related genes in DLBCL, we employed bioinformatics techniques. Specifically, we analyzed the differentially expressed genes (DEGs) in the GSE25638 dataset using Weighted Gene Co-expression Network Analysis (WGCNA) and performed functional enrichment analysis. By building a Protein-Protein Interaction (PPI) network, candidate genes were identified. Gene Set Enrichment Analysis (GSEA) and Receiver Operating Characteristic (ROC) curve analysis were used to confirm the clinical diagnostic use of these genes. The effects of Antioxidant 1 (ATOX1) knockdown, CuCl2, and DCAC50 treatments on DLBCL cells and the activation of the Mitogen-Activated Protein Kinase (MAPK) pathway were investigated by conducting in vitro experiments. Bioinformatics and in vitro experiments confirmed elevated expression of ATOX1 in DLBCL cells and tumor samples. ATOX1 knockdown led to decreased cell proliferation and G2 cell cycle arrest in vitro. Additionally, Phosphorylated Extracellular Signal-Regulated Kinases 1 and 2 (P-ERK1/2) protein levels within the MAPK pathway were reduced as a result of ATOX1 knockdown, but these levels were recovered by CuCl2. Treatment with DCAC50 showed a dose-dependent antiproliferative effect in DLBCL cells, which was strengthened by ATOX1 knockdown. Our study demonstrated that ATOX1 may be important in DLBCL via controlling the MAPK pathway through copper transport, providing new insights into potential therapeutic strategies for DLBCL.

Metagenomic approach for the isolation of a thermostable ß-galactosidase with high tolerance of galactose and glucose from soil samples of Turpan Basin.

BACKGROUND: ß-Galactosidases can be used to produce low-lactose milk and dairy products for lactose intolerant people. Although commercial ß-galactosidases have outstanding lactose hydrolysis ability, their thermostability is low, and reaction products have strong inhibition to these enzymes. In addition, the ß-galactosidases possessing simultaneously high thermostability and tolerance of galactose and glucose are still seldom reported until now. Therefore, identification of novel ß-galactosidases with high thermostability and tolerance to reaction products from unculturable microorganisms accounting for over 99% of microorganisms in the environment via metagenomic strategy is still urgently in demand. RESULTS: In the present study, a novel ß-galactosidase (Gal308) consisting of 658 amino acids was identified from a metagenomic library from soil samples of Turpan Basin in China by functional screening. After being overexpressed in Escherichia coli and purified to homogeneity, the enzymatic properties of Gal308 with N-terminal fusion tag were investigated. The recombinant enzyme displayed a pH optimum of 6.8 and a temperature optimum of 78 °C, and was considerably stable in the temperature range of 40 °C - 70 °C with almost unchangeable activity after incubation for 60 min. Furthermore, Gal308 displayed a very high tolerance of galactose and glucose, with the highest inhibition constant K(i,gal) (238 mM) and K(i,glu) (1725 mM) among ß-galactosidases. In addition, Gal308 also exhibited high enzymatic activity for its synthetic substrate o-nitrophenyl-ß-D-galactopyranoside (ONPG, 185 U/mg) and natural substrate lactose (47.6 U/mg). CONCLUSION: This study will enrich the source of ß-galactosidases, and attract some attentions to ß-galactosidases from extreme habitats and metagenomic library. Furthermore, the recombinant Gal308 fused with 156 amino acids exhibits many novel properties including high activity and thermostability at high temperatures, the pH optimum of 6.8, high enzyme activity for lactose, as well as high tolerance of galactose and glucose. These properties make it a good candidate in the production of low-lactose milk and dairy products after further study.

[Influence of Denitrification on Cyanobacterial Blooms Trends in Lake Taihu, China].

Denitrification is a major process in aquatic ecosystems, and it competes with cyanobacterial growth for nitrogen. However, the effect of denitrification on cyanobacterial blooms under the background of climate change remains unclear. This study explored the interaction between lake denitrification and formation of cyanobacterial blooms, using the historical water quality monitoring data of North Lake Taihu over five years from 2017 to 2021 and via incubation experiments of cyanobacteria and sediment denitrification. The monitoring data showed that algal biomass (Chla as a proxy) primarily peaked during summer and autumn. The seasonal variations in total N concentration showed a completely opposite trend than that of algal biomass, which peaked in winter and spring. Nitrate was the major component of dissolved inorganic nitrogen, and the nitrate concentration was approximately zero in summer and autumn. The total phosphorus concentration varied in the same way as the Chla concentration. The experimental results showed that Cyanobacteria did not grow when the temperature was below 20℃. In comparison, denitrification showed a significant linear relationship with temperatures between 10-25℃ (R2=0.99) and reached the maximum value of (62.98±21.36) µmol·(kg·h)-1 in Lake Taihu at 25℃. Additionally, the nitrate concentration threshold at the maximum denitrification rate was 4 mg·L-1. Cyanobacteria assimilate nitrate for growth, thereby reducing the concentration of nitrate required for denitrification. This study indicated that the advance in lake temperature warming due to climate change may result in earlier growth of cyanobacteria, thereby leading to large amounts of N being assimilated by algae before denitrification, further affecting the dynamics of cyanobacterial blooms. The present results are scientifically important for explaining the mechanism of cyanobacterial bloom rebound in Lake Taihu under the background of recent climate changes.

Gene synthesis method based on overlap extension PCR and DNAWorks program.

Gene synthesis by chemical methods provides a powerful tool for modifying genes and exploring their structure, expression, and function in the post-genomic era. However, a bottleneck in recent gene synthesis technologies is the high cost of oligonucleotide synthesis and post-synthesis sequencing. Here, we describe a simple, rapid, and low-cost gene synthesis method based on overlap extension PCR (OE-PCR) and the DNAWorks program. This method enables DNA sequences with sizes ranging from 200 bp to 3 kb to be synthesized with few errors, and these errors can be easily corrected by site-directed mutagenesis. Thus, it is amenable to automation for the multiplexed synthesis of different genes and has a potential for high-throughput gene synthesis.