Determination of the biodegradability of chitosan utilizing the most probable number technique

The present work aimed to evaluate the degradability of the chitosan polymer by soil microorganisms.This evaluation was accomplished using the Most Probable Number (MPN) method by plating in drops so that soil microorganisms capable of degrading the polymeric material could be quantified. Soil samples diluted in three specific culture media for each typeof microorganism were plated –bacteria, fungi and actinobacteria–and they were maintained at 28°C for seven days to determine the growth rate of fungi and actinobacteria, and for 48hoursfor the development of bacteria. Significant differences in the MPN of actinobacteriarelative to the other groups analyzed were observed. Thus, the method used was effective for determining the degradability of the chitosan biopolymer when observing the development of microorganisms subjected to the replacement of thecarbonsource by the addition of 2% w v-1of the chitosan biopolymer to the culture medium. The formation of clear regions around the microbial colonies was a strong indicator of biodegradation.

Spoilage potential of spore-forming bacteria from refrigerated raw milk / Potencial deteriorante de bactérias formadoras de esporos do leite cru refrigerado

Aerobic bacterial spores are an important group of microorganisms in raw milk. These microbes are thermoduric, whereas the vegetative forms are thermophilic, thermoduric and psychrotrophic and reduce the shelf life of pasteurized milk. In Brazil, there are a lack of studies on the load of aerobic spores in raw milk; thus, little is known about the spoilage activity of these organisms. The aim the present study was to quantify the aerobic spores in Brazilian refrigerated raw milk of dairy region of Castro, Paraná state, assess the potential proteolytic and/or lipolytic isolates and identify the microorganisms derived from the germination. Twenty milk samples were evaluated, and the aerobic spore count was performed after plating the samples following heat treatment at 80ºC for 12 min. The activity proteolytic and lipolytic isolates were evaluated through subculture on milk agar and tributyrin agar, respectively, and these microorganisms were identified using partial 16S rRNA gene sequences that were compared through GenBank. The aerobic spore counts ranged from 1 to 3.7 log CFU.mL-¹, with a mean of 1.75 (± 0.59) log CFU.mL-¹. After spore germination, 137 aerobic bacterial isolates were obtained, 40 of which (29.2%) showed milk spoilage activity. Among these, 31 isolates (77.5%) were proteolytic and lipolytic, seven isolates (17.5%) were exclusively lipolytic and two isolates (5%) were only proteolytic. Based on the 16S rRNA gene analysis, Bacillus licheniformis (55%), Bacillus spp. (27.5%), Paenibacillus spp. (7.5%), Bacillus pumilus (5%), Bacillus circulans (2.5%) and Brevibacillus spp. (2.5%) were identified. Studies of Brazilian raw milk microbiota have not yet described B. circulans which are frequently detected in milk from other countries. Among the 22 B. licheniformis isolates, 21 microbes (95.5%) showed proteolytic and lipolytic activity, and one isolate (4.5%) exhibited only proteolytic activity. The two B. pumilus isolates were proteolytic...(AU)

Esporos de bactérias aeróbias são um importante grupo de micro-organismos no leite cru. Esses micro-organismos são termodúricos, e suas formas vegetativas são termofílicas, termodúricas e psicrotróficas e reduzem a vida útil do leite pasteurizado. No Brasil, não há estudos sobre os esporos aeróbios no leite cru, assim, pouco se sabe sobre o potencial deteriorante dessa microbiota no leite cru brasileiro. O objetivo do presente trabalho foi quantificar esporos aeróbios no leite cru refrigerado brasileiro, avaliar o seu potencial proteolítico e/ou lipolítico e identificar esses micro-organismos originários da germinação dos esporos. Foram avaliadas 20 amostras de leite cru refrigerado, nas quais foi realizada a contagem de esporos aeróbios após o tratamento térmico de 80ºC por 12 min. A atividade proteolítica e/ou lipolítica dos isolados foi avaliada após o repique das colônias em ágar leite e tributirina, respectivamente, e a identificação desses micro-organismos deteriorantes foi realizada pelo sequenciamento parcial do gene 16S rRNA e comparação com as sequencias depositadas no GenBank. As contagens de esporos aeróbios variaram de 1 a 3.7 log CFU.mL-¹, com média de 1.75 (± 0.59) log UFC.mL-¹. Após a germinação dos esporos, foram obtidas 137 colônias, das quais 40 (29.2%) apresentaram algum tipo de atividade deteriorante: 31 (77.5%) isolados foram proteolíticos e lipolíticos, sete (17.5%) foram exclusivamente lipolíticos e dois (5%) foram apenas proteolíticos. Baseado nas sequencias do gene 16S rRNA, foram identificados Bacillus licheniformis (55%), Bacillus spp. (27.5%), Paenibacillus spp. (7.5%), Bacillus pumilus (5%), Bacillus circulans (2.5%) e Brevibacillus spp. (2.5%) entre os esporulados deteriorantes. Estudos preliminaries sobre a microbiota do leite brasileiro ainda não haviam descrito B. circulans e Paenibacillus, gêneros frequentemente descritos no leite de outros países. Entre os 22 B. licheniformis...(AU)

Interação entre células mesenquimais adipoderivadas e scaffold de poli (ácido lático-coglicólico) e poli (isopreno) epox confeccionado a partir de centrifugal spinning: estudo in vitro

A engenharia de tecidos compreende o uso de células tronco mesenquimais associadas com biomateriais, tendo como finalidade o reparo, regeneração e restauração de tecidos lesados. O objetivo desse trabalho foi avaliar a interação entre células mesenquimais adipoderivadas de humanos com scaffold de PLGA/PI epox, confeccionado através da técnica de centrifugal spinning. Preconizou-se, a partir de testes in vitro, o estabelecimento da melhor densidade de plaqueamento entre 0,325x105, 0,65x105 e 1,3x105 e melhor tempo de cultivo entre 24, 48 ou 72 horas. A partir das características fibroblastóides, aderência a garrafas plásticas de cultivo celular, diferenciação em linhagens adipogênicas e osteogênicas e imunofenotipagem positiva para CD90 e CD105 e negativa para CD34 e CD45, as células utilizadas neste estudo foram consideradas tronco mesenquimais. A integração das células à matriz fibrosa foi observada por meio de microscopia eletrônica de varredura, onde foi possível evidenciar a emissão de pseudópodes celulares. As fibras confeccionadas pela técnica de centrifugal spinning apresentaram-se fibrosas e porosas, com diâmetro médio de 3,61±2,81m, tendo uma maior representatividade de fibras com 1m (n=113). A atividade metabólica das células cultivadas junto ao biomaterial foi similar aos seus respectivos controles (células aderidas no fundo da placa, padrão ouro) (p>0,05). A exceção evidenciada entre os grupos testes e controle, perante ao teste de MTT, foi notória no cultivo de 1,3x105 em 72 horas, onde as células cultivadas junto ao scaffold mostraram-se metabolicamente mais ativas que o controle (2,87±0,30; 2,18±0,15, p>0,05), demonstrando a não interferência do biomaterial na viabilidade celular. A menor absorbância foi no grupo de 0,325x105 ADSCs (0,69±0,19; 1,27±0,46; 1,25±0,43, diferindo em todos os tempos de avaliação em relação ao grupo de 1,3x105 células (1,96±0,53; 2,45±0,26; 2,87±0,30, p<0,05), porém foi homogênea ao plaqueamento de 0,65x105 (1,02±0,24; 2,07±0,71; 1,77±0,56, p>0,05). Esse último, apresentou menor absorbância quando contrastado ao grupo de maior densidade nas avaliações de 24 e 72 horas (p<0,05). Perante a coloração do citoesqueleto celular, não foram demonstradas alterações quando as células foram cultivadas junto as matrizes fibrosas, independente do tempo de incubação e densidade. A contagem celular foi realizada por meio da coloração nuclear com DAPI, onde a maior média obtida por campo foi no plaqueamento de 1,3x105 células, durante 24 horas (529±81,70). Porém, há uma tendência ao descolamento celular com o passar das horas, podendo se justificar pelas forças moleculares atuantes entre o scaffold e as células e por ter um número alto de células aderidas incialmente. Porém, as células retornam a proliferar em 72 horas de avaliações. Fundamentado nos achados descritos acima, constatamos que o plaqueamento de 1,3x105 por 24 horas foi o mais eficaz. Ademais, o uso do biomaterial junto ao cultivo durante três dias de avaliações, não interferiu na viabilidade e morfologia das células. Segundo esses resultados, associação entre PLGA/PI epox e células mesenquimais adipoderivadas podem ser consideradas para futuros estudos in vivo na engenharia de tecidos

Tissue engineering comprises the use of mesenchymal stem cells associated with biomaterials, with the purpose of repairing, regenerating and restoring damaged tissues. The aim of this work was to evaluate the interaction between human adipoderivated mesenchymal cells with PLGA/PI epox scaffold, made using the centrifugal spinning technique. It was recommended, based on in vitro tests, the establishment of the best plating density between 0.325x105, 0.65x105 and 1.3x105 and the best culture time between 24, 48 or 72 hours. From fibroblastoid characteristics, adherence to plastic bottles of cell culture, differentiation into adipogenic and osteogenic lines and positive immunophenotyping for CD90 and CD105 and negative for CD34 and CD45, the cells used in this study were considered mesenchymal stem. The integration of cells in the fibrous matrix was observed by means of scanning electron microscopy, where it was possible to evidence the emission of cellular pseudopods. The fibers made by the spinning centrifugal technique were fibrous and porous, with an average diameter of 3.61±2.81m, with a greater representation of fibers with 1m (n = 113). The metabolic activity of cells grown next to the biomaterial was similar to their respective controls (cells adhered to the bottom of the plate, gold standard) (p> 0.05). The exception shown between the test and control groups, compared to the MTT test, was evident in the cultivation of 1.3x105 in 72 hours, where cells cultured next to the scaffold were more metabolically active than the control (2.87±0.30; 2.18±0.15 p>0.05), demonstrating the non-interference of the biomaterial in cell viability. The lowest absorbance was in the group of 0.325x105 ADSCs (0.69±0.19; 1.27±0.46; 1.25±0.43, differing at all times in relation to the 1.3x105 group cells (1.96±0.53; 2.45±0.26; 2.87±0.30, p <0.05), but it was homogeneous at 0.65x105 (1.02± 0.24; 2.07±0.71; 1.77±0.56, p> 0.05) .The latter showed lower absorbance when compared to the group with higher density in the 24 and 72 hour evaluations (p<0.05). Due to the staining of the cell cytoskeleton, no changes were demonstrated when the cells were cultured with fibrous matrices, regardless of the incubation time and density. Cell count was performed by means of nuclear staining with DAPI, where the highest average obtained by field was in the plating of 1.3x105 cells for 24 hours (529±81.70). However, there is a tendency for cell detachment over time, which may be justified by the molecular forces acting between the scaffold and the cells and for having a high number of cells adhered initially. However, the cells return to proliferate in 72 hours of evaluations. Based 8 on the findings described above, we found that the plating of 1.3x105 for 24 hours was the most effective. In addition, the use of biomaterial with the culture during three days of evaluations, did not interfere in the viability and morphology of the cells. According to these results, an association between PLGA/PI epox and adipoderivated mesenchymal cells can be considered for future in vivo studies in tissue engineering

USO DE SORO DE LEITE BOVINO IN NATURA NA ALIMENTAÇÃO DE SUÍNOS PÓS-DESMAME

Atualmente diversos resíduos agroindustriais vêm sendo pesquisados na alimentação animal mediante a necessidade de redução de poluentes, além disso, a inclusão de alimentos líquidos com melhor palatabilidade tem sido utilizada como uma estratégia no intuito de melhorar o ganho de peso, conversão alimentar, microbiota intestinal e a saúde dos animais. Este trabalho teve como objetivo avaliar consumo de ração, desempenho e qualidade intestinal de leitões alimentados com ração e soro de leite bovino integral após o desmame. Foram delineados por blocos ao acaso, com dois tratamentos: Um sem a adição de soro bovino e outro com a adição de soro. Foram delineados por blocos ao acaso, com dois tratamentos: Um sem a adição de soro de leite bovino in natura (tratamento B) e outro com a adição de soro (tratamento A). Cada tratamento teve 12 repetições. As repetições foram dividas em 4 blocos. Cada bloco teve duração de 21 dias, sendo iniciado o próximo bloco somente quando atendido o número de animais necessários com mesma idade e peso e após a limpeza e desinfecção das instalações. Foram distribuídos 4 animais por unidade experimental, totalizando 96 leitões desmamados aos 28 dias de idade. Foram coletadas amostras de no máximo 100 gramas de fezes diretamente da ampola retal de um leitão por unidade experimental no início do ensaio, com 7, 14 e 21 dias pós-desmame. Cada amostra foi armazenada em potes coletores esterilizados e mantida refrigerada para ser analisada em laboratório, para contagem de Unidades Formadoras de Colónias (UFC) para coliformes e lactobacillus spp.. Essas amostras foram preparadas e diluídas, adicionando-se 1 g de fezes em 99 ml de solução-tampão fosfato pH 7,2, obtendo-se uma diluição inicial de 1:100. Após diluições sucessivas até 10-8, procedeu-se o plaqueamento nos meios específicos. Para as variáveis de desempenho (ganho de peso, consumo de ração e conversão alimentar) e análises microbiológicas (UFC de lactobacillus spp. e coliformes) a baia foi considerada uma unidade experimental. Os dados obtidos foram avaliados pelo pacote ANOVA utilizando limites de 5% de probabilidade, o programa estatístico computacional utilizado foi R Core Team (2018). Não foi observada diferença significativa (P<0,05) para consumo de ração (P= 0,109) e ganho de peso diário (P= 0,634), diferentemente para conversão alimentar (P= 0,032). Não foi observada diferença significativa para avaliação da microbiota gastrointestinal (P<0,05) para primeira (P=0,159) e segunda (P=0,722) coleta, enquanto nas coletas três (P=0,033) e quatro (P=0,038), havendo ganho na relação lactobacillus:Coliformes. O soro de leite bovino na forma in natura pode ser utilizado para leitões em fase pós-desmame, pois melhora a conversão alimentar e a relação lactobacillus spp.:coliformes fecais

Currently, several agroindustrial residues have been investigated in animal feed through the need to reduce pollutants; in addition, the inclusion of liquid foods with better palatability has been used as a strategy to improve weight gain, feed conversion, intestinal microbiota and the health of animals. The objective of this study was to evaluate the dietary intake, performance and intestinal quality of piglets fed whole ration and whole cow whey after weaning. They were drawn in randomized blocks with two treatments: one without the addition of bovine serum and another with the addition of serum. They were randomized block design with two treatments: one without the addition of fresh bovine serum (treatment B) and another with the addition of serum (treatment A). Each treatment had 12 replicates. The replicates were divided into 4 blocks. Each block had a duration of 21 days, and the next block was started only when the number of necessary animals of the same age and weight was met, and after cleaning and disinfection of the facilities. Four animals per experimental unit were distributed, totaling 96 piglets weaned at 28 days of age. Samples of a maximum of 100 grams of faeces were collected directly from the rectal bulb of one piglet per experimental unit at the beginning of the trial, at 7, 14 and 21 days post-weaning. Each sample was stored in sterile collection pots and kept refrigerated for laboratory analysis, for counting Colony Forming Units (CFU) for coliforms and lactobacillus. These samples were prepared and diluted by adding 1 g feces in 99 ml phosphate buffer solution pH 7.2 to give an initial dilution of 1: 100. After successive dilutions up to 10-8, the plating was carried out on the specific media. For the performance variables (weight gain, feed intake and feed conversion) and microbiological analyzes (CFU of lactobacillus spp. And coliforms) the bay was considered an experimental unit. The obtained data were evaluated by the ANOVA package using limits of 5% of probability, the statistical computer program used was R Core Team (2018). There was no significant difference (P <0.05) for feed intake (P = 0.109) and daily gain (P = 0.634), differently for feed conversion (P = 0.032). No significant difference was observed for the evaluation of the gastrointestinal microbiota (P <0.05) for the first (P = 0,159) and second (P = 0,722) collection, while in the three collections (P = 0,033) and four (P = 0,038) having gained in the relation lactobacillus: Coliformes. The bovine whey in the in natura form can be used for piglets in the post-weaning phase, since it improves feed conversion and lactobacillus spp: fecal coliforms ratio.

Assessing the growth and recovery of Salmonella Enteritidis SE86 after sodium dichloroisocyanurate exposure

The objective of the present study was to assess the growth and the recovery of Salmonella (S.) Enteritidis SE86 in different diluents, culture media and using different plating methods after the exposure to 200 mg/kg sodium dichloroisocyanurate (NaDCC). Before and after NaDCC exposure, SE86 was cultured at 30 °C and 7 °C in the following diluents: Peptone water (P), Saline solution (SaS), Peptone water+Saline solution (P+SaS), Peptone water+Tween 80+Lecithin+Sodium thiosulfate (P+N) and Saline solution+Tween 80+Lecithin+Sodium thiosulfate (SaS+N). The SaS diluent was chosen because it was able to maintain cells viable without growth and was further used for plating SE86 on non selective medium (Tryptic Soy Agar-TSA) and on selective media (Mannitol Lysine Crystal Violet Brilliant Green Agar-MLCB, Brilliant Green Agar-BGA, Salmonella Shigella Agar-SS and Xylose Lysine Dextrose-XLD). The Thin Agar Layer method (TAL) i.e., selective media overlayed with non selective TSA was also evaluated. Results indicated that SE86 not exposed to NaDCC was able to grow in P, P+N, SaS+N and P+SaS, but not in SaS, that was able to maintain cells viable. SE86 exposed to NaDCC demonstrated similar counts after dilution in SaS and the plating on non selective TSA, selective media MLCB, BGA, SS and XLD and on TAL media. SE86, S. Typhimurium and S. Bredeney, exposed or not exposed to NaDCC, showed no significant differences in counts on TSA, XLD and XLD overlayed with TSA, suggesting that all those media may be used to quantify NaDCC-exposed Salmonella by plating method.(AU)

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG, R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.(AU)

Ochratoxigenic fungi associated with green coffee beans (Coffea arabica L. ) in conventional and organic cultivation in Brazil.

The genera Aspergillus comprises species that produce mycotoxins such as aflatoxins, ochratoxins and patulin. These are cosmopolitan species, natural contaminants of agricultural products. In coffee grains, the most important Aspergillus species in terms of the risk of presenting mycotoxins belong to the genera Aspergillus Section Circumdati and Section Nigri. The purpose of this study was to assess the occurrence of isolated ochratoxigenic fungi of coffee grains from organic and conventional cultivation from the South of Minas Gerais, Brazil, as well as to evaluate which farming system presents higher contamination risk by ochratoxin A (OTA) produced by fungi. Thirty samples of coffee grains (Coffea arabica L.) were analysed, being 20 of them of conventional coffee grains and 10 of them organic. The microbiological analysis was done with the Direct Plating Technique in a Dichloran Rose Bengal Chloramphenicol Agar (DRBC) media. The identification was done based on the macro and micro morphological characteristics and on the toxigenic potential with the Plug Agar technique. From the 30 samples analysed, 480 filamentous fungi of the genera Aspergillus of the Circumdati and Nigri Sections were isolated. The ochratoxigenic species identified were: Aspergillus auricoumus, A. ochraceus, A. ostianus, A. niger and A. niger Aggregate. The most frequent species which produces ochratoxin A among the isolated ones was A. ochraceus, corresponding to 89.55%. There was no significant difference regarding the presence of ochratoxigenic A. ochreceus between the conventional and organic cultivation systems, which suggests that the contamination risk is similar for both cultivation systems.(AU)

Effect of the spontaneous fermentation and the ageing on the chemo-sensory quality of Brazilian organic cachaça

This study verified the effect of the spontaneous fermentation/natural ferment (NF) on the chemo-sensory quality of cachaça, comparing to the commercial ferment (CF). The effect of ageing (maturation) was also analysed in the beverage. Microbiological analysis (plating on selective media for total/wild yeast and bacteria counting) and physico-chemical analysis (pH, acidity and soluble solids) were performed in the samples of the must and the ferment collected during three cycles of fermentation in a semi-industrial scale. Samples of cachaça were stored in 5-L oak containers for 45 days, subsequently analyzing the physico-chemical characteristics (pH, acidity, alcohol content, copper and secondary compounds) and sensory acceptability (aroma, flavour, colour, body and global impression). The fermentation with NF showed higher number of wild yeasts; however there was no difference in the number of bacteria comparing to CF. An intense acidification occurred during the preparation of NF, which was also observed in the initial cycles of fermentation, but decreased afterwards. Greater alterations in cachaça composition were found to be more exclusively related to the maturation than to the type of ferment, except for the acidity. However, there was a significant loss of aroma, flavour and global impression after maturation but only in cachaça produced with the CF. The results revealed a strong interaction between ferment and maturation of the beverage, suggesting that substances produced by the microorganisms from different inocula during fermentation reacted differently with the wood components of the barrels influencing the sensory attributes.

Este trabalho teve por objetivo avaliar o efeito da fermentação espontânea/fermento natural (NF) sobre a qualidade fisico-química e aceitabilidade da cachaça, comparando-se com o fermento comercial (CF). O efeito do envelhecimento (maturação) da bebida foi também avaliado. Análises microbiológicas (plaqueamento em meios seletivos para contagem de leveduras totais/selvagens e bactérias) e físico-químicas (pH, acidez e sólidos solúveis) foram conduzidas nas amostras do mosto e do fermento coletadas durante três ciclos fermentativos (escala semi-industrial). Amostras de cachaça foram armazenadas em barris de carvalho de 5 litros por 45 dias, seguindo-se a análise físico-química (pH, acidez, teor alcoolico, cobre e compostos secundários) e de aceitabilidade sensorial (aroma, sabor, cor, corpo e impressão global). A fermentação com NF mostrou maior número de leveduras selvagens; no entanto, não houve diferença significativa no número de bactérias quando comparada com CF. Uma intensa acidificação foi observada durante o preparo de NF, a qual foi verificada nos ciclos iniciais da fermentação, decrescendo a seguir. As alterações na composição da cachaça foram mais significativas em relação à maturação do que ao tipo de fermento, com exceção da acidez. No entanto, houve uma perda significativa de aroma, sabor e impressão global após a maturação na cachaça produzida com CF. Os resultados revelaram uma forte interação entre fermento e envelhecimento (maturação) da bebida, sugerindo que substâncias produzidas pelos microrganismos a partir de inóculos diferentes reagiram diferentemente com componentes da madeira dos barris, influenciando nos atributos sensoriais de aceitabilidade.

Effect of the spontaneous fermentation and the ageing on the chemo-sensory quality of Brazilian organic cachaça

This study verified the effect of the spontaneous fermentation/natural ferment (NF) on the chemo-sensory quality of cachaça, comparing to the commercial ferment (CF). The effect of ageing (maturation) was also analysed in the beverage. Microbiological analysis (plating on selective media for total/wild yeast and bacteria counting) and physico-chemical analysis (pH, acidity and soluble solids) were performed in the samples of the must and the ferment collected during three cycles of fermentation in a semi-industrial scale. Samples of cachaça were stored in 5-L oak containers for 45 days, subsequently analyzing the physico-chemical characteristics (pH, acidity, alcohol content, copper and secondary compounds) and sensory acceptability (aroma, flavour, colour, body and global impression). The fermentation with NF showed higher number of wild yeasts; however there was no difference in the number of bacteria comparing to CF. An intense acidification occurred during the preparation of NF, which was also observed in the initial cycles of fermentation, but decreased afterwards. Greater alterations in cachaça composition were found to be more exclusively related to the maturation than to the type of ferment, except for the acidity. However, there was a significant loss of aroma, flavour and global impression after maturation but only in cachaça produced with the CF. The results revealed a strong interaction between ferment and maturation of the beverage, suggesting that substances produced by the microorganisms from different inocula during fermentation reacted differently with the wood components of the barrels influencing the sensory attributes.

Este trabalho teve por objetivo avaliar o efeito da fermentação espontânea/fermento natural (NF) sobre a qualidade fisico-química e aceitabilidade da cachaça, comparando-se com o fermento comercial (CF). O efeito do envelhecimento (maturação) da bebida foi também avaliado. Análises microbiológicas (plaqueamento em meios seletivos para contagem de leveduras totais/selvagens e bactérias) e físico-químicas (pH, acidez e sólidos solúveis) foram conduzidas nas amostras do mosto e do fermento coletadas durante três ciclos fermentativos (escala semi-industrial). Amostras de cachaça foram armazenadas em barris de carvalho de 5 litros por 45 dias, seguindo-se a análise físico-química (pH, acidez, teor alcoolico, cobre e compostos secundários) e de aceitabilidade sensorial (aroma, sabor, cor, corpo e impressão global). A fermentação com NF mostrou maior número de leveduras selvagens; no entanto, não houve diferença significativa no número de bactérias quando comparada com CF. Uma intensa acidificação foi observada durante o preparo de NF, a qual foi verificada nos ciclos iniciais da fermentação, decrescendo a seguir. As alterações na composição da cachaça foram mais significativas em relação à maturação do que ao tipo de fermento, com exceção da acidez. No entanto, houve uma perda significativa de aroma, sabor e impressão global após a maturação na cachaça produzida com CF. Os resultados revelaram uma forte interação entre fermento e envelhecimento (maturação) da bebida, sugerindo que substâncias produzidas pelos microrganismos a partir de inóculos diferentes reagiram diferentemente com componentes da madeira dos barris, influenciando nos atributos sensoriais de aceitabilidade.

Análise microbiológica da superfície de latas de cerveja comercializadas em Itabuna-BA

A cerveja é uma bebida alcoólica comercializada frequentemente em latas de alumínio devido à praticidade no consumo. Este tipo de embalagem entra em contato direto com a boca do consumidor e necessita de um cuidado redobrado com relação aos aspectos de higienização para não ser um veículo de micro-organismos patogênicos. O trabalho objetivou avaliar a presença de micro-organismos aeróbios mesófilos e enterobactérias nas superfícies das latas de cerveja comercializadas no município de Itabuna, Bahia. Foram coletadas 48 latas de cerveja (24 com vendedores ambulantes e 24 em supermercados) no mês de setembro de 2012 e realizou-se a Técnica do Esfregaço de Superfície com plaqueamento do inóculo em profundidade nos meios de cultura PCA e VRBD. A presença dos micro-organismos aeróbios mesófilos foi determinada com contagens acima de 300 UFC/cm2, em 70,8% e 12,5% das amostras coletadas com ambulantes e em supermercados, respectivamente. Já as enterobactérias tiveram presença acima de 300 UFC/cm2 em 37,5% das amostras dos ambulantes e contagens abaixo de 50 UFC/cm2 em 100% das amostras coletadas em supermercados. As altas contagens de micro-organismos aeróbios mesófilos e enterobactérias na superfície das latas coletadas com ambulantes indicaram a necessidade de boas práticas higiênicas na comercialização da bebida.(AU)

Beer is an alcoholic beverage often marketed in aluminum cans because of the convenience in use. This type of packaging is in direct contact with the consumers mouth and needs a special care regarding the hygiene aspects not to be a vehicle of pathogenic microorganisms. The study aimed to evaluate the presence of mesophilic aerobic microorganisms and enterobacteria on the surfaces of cans of beer sold in the city of Itabuna, Bahia. They collected 48 cans of beer (24 with street vendors and 24 supermarkets) in September 2012 and held the surface smear technique with the plating of inoculum in depth in the PCA and VRBD culture media. The presence of mesophilic aerobic microorganisms was determined above 300 CFU / cm2 counts in 70.8% and 12.5% of the samples collected from street and supermarkets, respectively. Enterobacteria already had presence above 300 CFU / cm2 in 37.5% of samples of street and scores below 50 CFU / cm2 at 100% of the samples collected in supermarkets. The high counts of mesophilic aerobic microorganisms and enterobacteria on the surface of cans collected with street indicated the need for good hygienic practices in the marketing of the drink.(AU)

Diferentes métodos e tempos de conservação de amostras de leite cru para determinação da composição físico-química e qualidade microbiológica

O presente estudo foi realizado objetivando comparar três métodos de conservação (sem adição de conservante, azidiol e bronopol), na conservação de leite cru destinado a análise de contagem bactéria total (CBT) pelo método de contagem padrão em placas,composição centesimal (gordura, proteína, lactose, sólidos totais e sólidos desengordurados), pH e do ponto de congelamento do leite. O trabalho também objetivou estudar a influência do período de armazenamento (dias), temperatura (refrigerado e não refrigerado) e a qualidade microbiológica inicial de amostras de leite cru. Foi utilizado delineamento em blocos casualizados com arranjo fatorial de 3 (métodos) x 2 (temperaturas) x 5 (tempos). A CBT foi influenciada pelo conservante, pois aos sete dias de armazenamento a amostra sem conservante apresentou maior CBT. Nas amostras com bronopol sem refrigeração houve redução gradual de CBT. Observou-se que as amostras conservadas com azidiol, independente da temperatura de armazenagem, reduziram a CBT ao longo do tempo. Atemperatura influenciou o teor de gordura (P<0,001. Os teores de proteína, lactose, sólidos desengordurados e densidade média do leite foram influenciados pelo tipo de conservante e dias de armazenamento (P<0,001). O pH foi influenciado pelo tipo de conservante e pelos dias de armazenamento (P<0,001). Para análises de CBT, o uso de azidiol, independente de refrigeração ou armazenagem, é o método mais adequado para manter as características originais do produto. A partir do primeiro dia de armazenamento das amostras ocorre aumento dos teores médios de proteína, lactose e sólidos desengordurados em relação aos quantificados no dia da coleta. Por outro lado, a CBT foi alterada de forma isolada pela CBT inicial, temperatura de armazenamento e dias de armazenagem (P<0,001). Houve aumento da CBT de acordo com os dias de armazenamento, uma vez que até o primeiro dia de armazenamento os valores aumentaram, já a partir do segundo dia de armazenamento a CBT começou a reduzir. Nos teores de gordura, houve apenas efeito de CBT inicial e temperaturade armazenamento (P<0,001). Nos percentuais de proteína houve efeito de dias de armazenamento, a proteína aumentou até o primeiro dia de armazenamento, onde estabilizou até 7 dias de armazenamento. Lactose foi alterada pela CBT inicial e pelos dias de armazenamento (P<0,001), teor de lactose aumentou até o primeiro dia de armazenamento, onde estabilizou até o sétimo dia. O teor de ST foi alterado pela CBT inicial, temperatura e dias de armazenamento (P<0,001), amostras com alta CBT inicial apresentaram maiores teores de ST. O teor de SD foi alterado apenas pela CBT inicial e pelos dias de armazenamento (P<0,001). O pH foi alterado pela CBT inicial, temperatura e dias de armazenamento. Para análise de CBT, o uso de azidiol como conservante é dependente do uso de refrigeração durante a armazenagem para manter as características microbiológicas mais estáveis ao longo de sete dias de armazenamento. Para análises de composição físico-química, a partir do primeiro dia de armazenamento das amostras, ocorreu aumento dos teores de proteína, lactose e sólidos desengordurados do leite, em relação aos teores observados quando quantificados no mesmo dia da coleta do leite

The present study aimed to compare three methods of conservation (no added preservative, azidiol and bronopol), conservation of raw milk for total bacteria count analysis (TBC) for the standard counting method plating, chemical composition (fat, protein, lactose, total solids and fat solids), pH and freezing of milk. The research also aimed to study the influence of the storage period (days), temperature (cooled and uncooled) and the initial microbiological quality of raw milk samples. It was used a randomized block design with factorial arrangement of 3 (methods) x 2 (temperature) x 5 (times). The TBC was influenced by the preservative, since after seven days of storage the sample without preservative had greater TBC. In the unrefrigerated samples with bronopol there was a gradual reduction of TBC. It was observed that the samples preserved with azidiol, regardless of storage temperature, TBC reduced over time. The temperature affected the fat content (P <0.001). The protein, lactose, solids and milk medium density were influenced by the type of preservative and storage days (P <0.001). The pH was influenced by the type of preservative and the storage days (P <0.001). For TBC analysis, the use of azidiol, independent of refrigeration or storage, is the most appropriate method to maintain the original characteristics of the product. From the first day of storage of the samples, there was an increase of the average levels of protein, lactose and degreased solids in relation to the quantified on the collection day. On the other hand, the TBC was changed isolated by the initial TBC, storage temperature and storage days (P <0.001). There was an increase of TBC according to the days of storage, since until the first day of storage values increased already from the second day of storage TBC started to reduce. In fat content, there was only initial TBC effect and storage temperature (P <0.001). In the protein percentage there was the effect of days of storage, the protein increased until the first day of storage, where it stabilized until 7 days of storage. Lactose was amended by initial TBC and the storage days (P <0.001), lactose increased until the first day of storage, which stabilized until the seventh day. The total solids (TS) content was amended by initial TBC, temperature and storage days (P <0.001), samples with high TBC showed higher initial TS levels. The SD content was changed only by the initial TBC and the storage days (P <0.001). The pH was amended by initial TBC, temperature and days of storage. For TBC analysis, using azidiol preservative is dependent on the use of refrigeration during storage to maintain more stable microbiological characteristics over seven days of storage. For analysis of physical and chemical composition, from the first day of sample storage, there was an increase of protein, lactose and fat solids of milk, compared to levels observed when quantified in the same day of collection of milk

Characterization of Aeromonas species isolated from an estuarine environment

Thirty water samples were collected, at two week intervals, from the estuary of the River Cocó. The aim was to characterize the presence, distribution and types of Aeromonas spp, in the estuary of the River Cocó, Ceara, Brazil (03º46'28.83''S e 38º26'36.52''S). Aeromonas were identified in 19 (63%) samples analyzed by plating and CFU counts. Presence/absence tests were positive for 11 (37%) of the samples resulting in the detection of Aeromonas in a total of 23 (77%) of samples. CFU counts varied from 10 to 1.4 x 10(4) CFU mL-1 . From the isolated strains seven species of Aeromonas were identified: A. caviae (29/69), A. veronii bv. sobria (13/69), A. veronii bv. veronii (8/69), A. trota (6/69), A. media (5/69), A. sobria (4/69) and A. hydrophila and Aeromonas sp. (2/69). Of the 38 strains tested, 23 (60%) showed resistance to at least one of the eight antimicrobials. Multiple resistance to antibiotics was observed in A. caviae, A. media, A. sóbria and A. veronii bv. sobria. Aeromonas caviae showed the highest multiple resistance, being resistant to four antibiotics. The presence of those microorganisms may contribute to the occurrence of gastroenteritis, mainly in children, since they are considered opportunists.

QUALIDADE MICROBIOLÓGICA E CONTAGEM DE CÉLULAS SOMÁTICAS DO LEITE DE VACAS MESTIÇAS COLETADO EM SATUBA-AL

A qualidade microbiológica do leite pode ser definida como a estimativa da contaminação por micro-organismos, que está relacionada com a saúde da glândula mamaria do rebanho e às condições gerais de manejo e higiene adotados na propriedade. A quantidade de células somáticas tem sido usada como importante ferramenta para o monitoramento da qualidade do leite. Objetivou-se verificar a qualidade mícrobiológica do leite cru e pasteurizado, contagem de células somáticas e contaminação do ambiente de ordenha em uma propriedade do município de Satuba. As análises seguiram metodologia descrita no "Compendium of Methods for the Microbiological Examination of Foods" e do Manual de Métodos de Analises Microbíológica de Alimentos. Foram realizadas coletas durante seis meses do ano de 2014. As amostras em cada etapa forma submetidas a contagens de aeróbios mesófilos em Agar Padrão de Contagem (PCA) a 28°C por cinco dias, psicrotróficos em PCA 7ºC por 10 dias, determinação do número mais provável (NMP) de coliformes totais (30°C por 48 horas), termotolerantes (45°C por 24 horas) e confirmação de Escherichia coli. Para analise de Staphylococcus spp, as amostras foram plaqueadas em meio especifico (Baird-Parker Agár Base Himédia M043) e incubadas a 37º/24h. Na detecção de Salmonella spp, utilizou-se meio de enriquecimento Selenito Cistina (37ºC/24h) seguido de plaqueamento para o meio Salmonella Shigella Agar (Acumedia 7152A). Para Listeria spp, foi utilizado o meio de Aloa A®PROTAC (37ºC/72h). As análises de composição química e Contagem de Células Somáticas foram realizadas pelo Programa de Gerenciamento de Rebanhos Leiteiros do Nordeste. Todas as amostras apresentaram alta contagem padrão em placa, os resultados variaram entre 4,84 Log10 a 5,78 Log10 UFC/mL. Nas contagens de mesófilos, 100% das amostras apresentaram contaminação. Com relação aos psicrotróficos, em 83,33% das coletas de leite cru foi identificada presença e no leite pasteurizado, esse valor caiu para 66,66%. Todas as coletas analisadas apresentaram 100% de não conformidade quanto a contagem de coliformes. Em 95,84% dos pontos analisado foi detectada a presença de Staphylococcus spp e em 100% das amostras houve ausência de Salmonella spp. Todas as coletas apresentaram contaminação por Listeria spp. A média da composição química esteve em conformidade com a legislação, exceto para o teor de gordura no leite cru, com 2,79%. Também nas amostras de leite houve alta contagem de células somáticas, com resultados variando entre 1,051x106 a 9,576x106 CS/mL. De acordo com os dados obtidos, conclui-se que a qualidade do leite colhido na propriedade estudada está fora dos parâmetros estabelecidos pela Instrução Normativa 62, provavelmente devido a falta de cuidados higiênicos no ambiente de ordenha.

The microbiological quality of milk can be defined as an estimated contamination by microorganisms, which is related to the health of the mammary gland of cattle and general conditions of handling and hygiene adopted in the property. The number of somatic cells has been used as an important tool for monitoring the quality of milk. The number of somatic cells has been used as an important tool for monitoring the quality of milk. The objective was to verify the microbiological quality of raw milk and pasteurized, somatic cell count and contamination of the milking environment in a property of the municipality of Satuba. The analysis followed the methodology described in the "Compendium of Methods for the Microbiological Examination of Foods" and Methods of Analyses Microbiological Food Guide. Collections were made during six months of 2014. The samples in each stage form submitted to aerobic mesophilic counts in Agar Count Standard (PCA) at 28 ° C for five days, psychrotrophic PCA 7 ° C for 10 days, determining the number most likely (PMN) total coliforms (30 ° C for 48 hours) thermotolerant (45 ° C for 24 hours) and confirmation of Escherichia coli. For analysis of Staphylococcus spp, samples were plated on specific medium (Baird-Parker Agar Base himedia M043) and incubated at 37 / 24h. In the detection of Salmonella spp was used enrichment medium selenite cystine (37 / 24h) followed by plating medium for Salmonella Shigella agar (Acumedia 7152A). To Listeria spp medium was used Aloa A®PROTAC (37 / 72h). The analysis of chemical composition and Somatic Cell Count were performed by the dairy herd management program of the Northeast. All samples showed high standard plate count, the results ranged from 4.84 log10 to 5.78 log10 UFC/mL. In mesophilic counts, 100% of the samples were contaminated. Regarding psychrotrophic, in 83.33% of raw milk samples was identified and presence in pasteurized milk, this value dropped to 66.66%. All the analyzed samples showed 100% of noncompliance as the coliform count. In 95.84% of the analyzed points detected the presence of staphylococcus and 100% of the samples was Salmonella spp. All samples were contaminated by Listeria spp . The average chemical composition was in accordance with the law, except for the fat content in raw milk, with 2.79%. Also the milk samples was high somatic cell count, with results ranging from 1,051x106 to 9,576x106 SC/mL. According to the data obtained, it is concluded that the quality of milk collected in the studied property is outside the parameters established by the Normative Instruction 62, probably due to lack of hygienic care in the milking environment.

Evaluation of three enrichment broths and five plating media for Salmonella detection in poultry

We evaluated the effectiveness of Selenite Cystine (SC), Tetrathionate Brilliant Green (TBG) and Rappaport Vassiliadis (RV) broths for Salmonella isolation. We also tested three classic plating media, Salmonella-Shigella Agar (SS), Brilliant Green Agar (BGA), Xylose Lysine Desoxycholate Agar (XLD) and two chromogenic agars, Rambach (RA) and CHROMagar Salmonella (CAS). Among 100 poultry carcasses, 29 were positive for Salmonella using all plating media combined. RV broth (69%) and TT broth (58.6%) were more effective than SC broth (24.1%). The chromogenic media gave better results than the classic ones with less false-positive colonies. The most effective isolation medium was CHROMagar, where Salmonella was identified in 23 (79.3%) of the 29 positive samples, followed by Rambach (48%). Positivity for Salmonella using classic media was 13.8% for BGA, 27.6% for SS and 34.5% for XLD.

A eficiência dos caldos selenito cistina (SC), tetrationato verde brilhante (TBG) e Rappaport Vassiliadis (RV) foi avaliada quanto ao isolamento de Salmonella. Também foram testados três meios clássicos de isolamento, ágar Salmonella-Shigella (SS), ágar Verde Brilhante (VB) e ágar xilose lisina desoxicolato (XLD) e dois meios cromogênicos, Rambach (RA) e CHROMagar (CAS). Entre 100 carcaças de frango examinadas, 29 foram positivas para Salmonella usando todos os meios combinados. Os caldos RV (69%) e TT (58,6%) foram mais eficientes que o SC (24,1%). Os meios cromogênicos mostraram melhores resultados do que os clássicos na detecção de Salmonella e apresentaram uma quantidade menor de colônias falso-positivas. O meio cromogênico mais eficiente foi o CAS, que detectou Salmonella em 23 das 29 amostras positivas (79,3%), seguido pelo RA (48%). Entre os meios clássicos, a detecção foi de 13,8% para VB, 27,6% para SS e 34,5% para XLD.

Comparação de Meios de Enriquecimento e de Plaqueamento Utilizados na Pesquisa de Salmonella em Carcaças de Frango e Fezes de Aves

This study was undertaken to compare selenite-cystine-novobiocin (SCN) broth, tetrationate-novobiocin (TN) broth and Rappaport-Vassiliadisnovobiocin (RVN) broth as enrichment and MacConkey (MC) agar, brilliant green (BG) agar, Hektoen (HE) agar, Salmonella-Shigella (SS) agar and xylose Iysine desoxycholate (XLD) agar as plating media for isolating Salmonella from broiler carcasses and chicken feces. The carcasses were washed with 300mL of Buffer Peptone Water 0.1% (BPW). The BPW solation was incubated 6h at ambient temperature and up to 24 h/43ºC. From this, 2 mL were inoculate in 20 mL of enrichment broth, incubated at 43ºC/24h. The enrichment broth was plated on the five tested selective agars, also incubated at 43ºC/24h. Up to five colonies from each plate were inoculated in TSI agar and LIA agar, incubated at 37ºC/24h. The genus of Salmonella was confirmed by slide agglutination test using poly serum anti-somatic Salmonella antigens (O) and poly serum anti-fiagellar (H) Salmonella antigens. The feces were experimentally contaminated with eight Salmonella serotypos (Agona, Anatum, Enteritidis, Havana, Intantis, Owakam, Schwazengrundand Typhimurium). Each serotype was tested five times. Salmonella serotypes were added in the sample of feces individually so that the final concentration of the bacterium was 1,2 x iO³ ufclg. Two grams of each sample were inoculated in 20 mL of the enrichment broth. The proceduring from this point wes the same adopted to carcasses examination. To broiler carcasses there was no statistic difference (p>0, 001) among the enrichment broth and among plating media. However the use of two enrichment broth (SCN and TN) and two agars between XLD agar, SS agar and HE agar gave the bost results. The assay done with feces showed that the TN broth was much better than the others and, in this case it can be plated either HE agar, or VB agar or SS agar The results from the broiler carcasses examination and the feces examination showed that it is not easy to determine the better bacteriologic routine to search for Salmonella and suggest that the association of two eorichments broth and two plating media may improve the test.

Este trabalho foi desenvolvido para avaliar, comparativamente, os caldos de enriquecimento Rapapport-novobiocina (RVN), selenito-cistinanovobiocina (SCN) e tetrationato-novobiocina (TN) e os meios para plaqueamento ágar Hektoen (HE), ágar MacConkey (MC), ágar Salmonella-Shigella (SS), ágar verde brilhante (VB) e ágar xilose lisina desoxicolato (XLD), utilizados no isolamento de Salmonella em carcaças de frango e fezes de aves. O procedimento bacteriológico consistiu das etapas de pré-enriquecimento, enriquecimento em caldos seletivos, plaqueamento, testes bioquímicos presuntivos e confirmação sorológica com soros polivalentes anti antígenos somáticos e flagelares de Salmonella.. As fezes foram experimentalmente contaminadas com 8 sorotipos de Salmonella (Agona, Anatum, Enteritidis, Havana, Infantis, Owakam, Schwazengrund e Typhimurium) e a concentração final foi aproximadamente de 1,2 x 10² ufc/g. As fezes foram inoculadas nos caldos enriquecedores e a partir daí, seguiu-se o mesmo procedimento utilizado para as carcaças. Os resultados referentes às carcaças de frango não foram estatisticamente diferentes (p>0,01) para os caldos e as placas. Todavia, verificou-se superioridade numérica em relação aos caldos SCN e TN sobre o caldo RVN, e em relação ao ágar XLD sobre os demais. Verificou-se também que com o emprego de dois caldos de enriquecimento e de dois meios para plaqueamento pode-se obter maior positividade. Quanto ao exame das fezes, o caldo TN mostrou-se superior aos demais (p>0,01), não havendo diferença (p>0,01) de resultados para os meios de plaqueamento. Os resultados sugerem que a utilização de mais de um meio de enriquecimento e de plaqueamento poderia aumentar as chances de isolamento de Salmonella.

Comparação de Meios de Enriquecimento e de Plaqueamento Utilizados na Pesquisa de Salmonella em Carcaças de Frango e Fezes de Aves

This study was undertaken to compare selenite-cystine-novobiocin (SCN) broth, tetrationate-novobiocin (TN) broth and Rappaport-Vassiliadisnovobiocin (RVN) broth as enrichment and MacConkey (MC) agar, brilliant green (BG) agar, Hektoen (HE) agar, Salmonella-Shigella (SS) agar and xylose Iysine desoxycholate (XLD) agar as plating media for isolating Salmonella from broiler carcasses and chicken feces. The carcasses were washed with 300mL of Buffer Peptone Water 0.1% (BPW). The BPW solation was incubated 6h at ambient temperature and up to 24 h/43ºC. From this, 2 mL were inoculate in 20 mL of enrichment broth, incubated at 43ºC/24h. The enrichment broth was plated on the five tested selective agars, also incubated at 43ºC/24h. Up to five colonies from each plate were inoculated in TSI agar and LIA agar, incubated at 37ºC/24h. The genus of Salmonella was confirmed by slide agglutination test using poly serum anti-somatic Salmonella antigens (O) and poly serum anti-fiagellar (H) Salmonella antigens. The feces were experimentally contaminated with eight Salmonella serotypos (Agona, Anatum, Enteritidis, Havana, Intantis, Owakam, Schwazengrundand Typhimurium). Each serotype was tested five times. Salmonella serotypes were added in the sample of feces individually so that the final concentration of the bacterium was 1,2 x iO³ ufclg. Two grams of each sample were inoculated in 20 mL of the enrichment broth. The proceduring from this point wes the same adopted to carcasses examination. To broiler carcasses there was no statistic difference (p>0, 001) among the enrichment broth and among plating media. However the use of two enrichment broth (SCN and TN) and two agars between XLD agar, SS agar and HE agar gave the bost results. The assay done with feces showed that the TN broth was much better than the others and, in this case it can be plated either HE agar, or VB agar or SS agar The results from the broiler carcasses examination and the feces examination showed that it is not easy to determine the better bacteriologic routine to search for Salmonella and suggest that the association of two eorichments broth and two plating media may improve the test.

Este trabalho foi desenvolvido para avaliar, comparativamente, os caldos de enriquecimento Rapapport-novobiocina (RVN), selenito-cistinanovobiocina (SCN) e tetrationato-novobiocina (TN) e os meios para plaqueamento ágar Hektoen (HE), ágar MacConkey (MC), ágar Salmonella-Shigella (SS), ágar verde brilhante (VB) e ágar xilose lisina desoxicolato (XLD), utilizados no isolamento de Salmonella em carcaças de frango e fezes de aves. O procedimento bacteriológico consistiu das etapas de pré-enriquecimento, enriquecimento em caldos seletivos, plaqueamento, testes bioquímicos presuntivos e confirmação sorológica com soros polivalentes anti antígenos somáticos e flagelares de Salmonella.. As fezes foram experimentalmente contaminadas com 8 sorotipos de Salmonella (Agona, Anatum, Enteritidis, Havana, Infantis, Owakam, Schwazengrund e Typhimurium) e a concentração final foi aproximadamente de 1,2 x 10² ufc/g. As fezes foram inoculadas nos caldos enriquecedores e a partir daí, seguiu-se o mesmo procedimento utilizado para as carcaças. Os resultados referentes às carcaças de frango não foram estatisticamente diferentes (p>0,01) para os caldos e as placas. Todavia, verificou-se superioridade numérica em relação aos caldos SCN e TN sobre o caldo RVN, e em relação ao ágar XLD sobre os demais. Verificou-se também que com o emprego de dois caldos de enriquecimento e de dois meios para plaqueamento pode-se obter maior positividade. Quanto ao exame das fezes, o caldo TN mostrou-se superior aos demais (p>0,01), não havendo diferença (p>0,01) de resultados para os meios de plaqueamento. Os resultados sugerem que a utilização de mais de um meio de enriquecimento e de plaqueamento poderia aumentar as chances de isolamento de Salmonella.

Comparison of different selective enrichment steps to isolate Salmonella sp. from feces of finishing swine

A two-phase study was conducted to compare the efficacy of several enrichment selective-broth steps associated to different plating media for recovery of Salmonella sp. from finishing swine feces. In a first phase, Rappaport-Vassiliadis broth (RV) incubated at 42ºC, Tetrathionate Müller-Kauffmann broth at 37ºC (TMK37) and 42ºC (TMK42), and Selenite Cystine broth (SC) at 37ºC, in combination with three selective plating media Rambach agar (RA), Xylose-Lysine-Tergitol 4 agar (XLT4), and Brilliant-Green Phenol-Red Lactose Sucrose agar (VB) were compared for recovery of Salmonella from artificially contaminated swine feces. In a second phase, RV, TMK37, and TMK42, associated with XLT4 and VB , were tested with naturally contaminated swine feces. In this study RV, TMK42 and TMK37 were superior to SC for isolating Salmonella sp. from artificially contaminated feces. TMK42 and RV were more productive than TMK37 for recovery of Salmonella from naturally contaminated feces samples. Selectivity and indication capability of the plating media were remarkably affected by the selective enrichment step effectiveness. The TMK42/XLT4 association was the most sensitive and RV/XLT4 the most specific. The use of VB agar is also recommended to increase the likelihood of isolating atypical H2S-late producing/ non-producing Salmonella. In this study RV and TMK42 were the most efficient selective enrichment for recovery of Salmonella sp. from swine feces.

Através de um estudo em duas fases comparou-se a eficiência de etapas de enriquecimento seletivo, associadas a diferentes meios seletivos, na recuperação de Salmonella sp. de fezes de suínos de terminação. Em uma primeira fase, as amostras foram contaminadas artificialmente e os caldos Rappaport-Vassiliadis (RV) incubado a 42ºC, Tetrationato Müller-Kauffmann a 37ºC (TMK37) e 42ºC (TMK42), e Selenito Cistina (SC) a 37ºC foram testados, em associação com meios sólidos seletivos: ágar Rambach (RA), ágar Xilose-Lisina-Tergitol 4 (XLT4), e ágar Verde-brilhante Vermelho-neutro Lactose Sacarose (VB). Na segunda fase os caldos RV, TMK37, and TMK42, semeados nos meios XLT4 and VB, foram testados com amostras naturalmente contaminadas. No isolamento de Salmonella sp. em amostras artificialmente contaminadas o RV, TMK42 e TMK37 foram superiores ao SC. Na segunda fase o TMK42 e RV foram mais eficientes que o TMK37. O desempenho destas etapas de enriquecimento seletivo influenciou diretamente a capacidade seletiva e indicadora dos meios sólidos seletivos utilizados. No presente estudo, a associação TMK42/XLT4 demonstrou ser a mais sensível, e a RV/XLT4 a mais específica. O uso do meio VB também é recomendado para aumentar a probabilidade do isolamento de colônias atípicas de Salmonella - produtoras tardias ou não produtoras de H2S. No presente estudo, RV e TMK42 foram as etapas de enriquecimento seletivo mais eficientes para o isolamento de Salmonella de fezes de suínos.

Comparação entre a eficiência de três meios de plaqueamento, para isolamento de Listeria spp., a partir de carne moída / Comparison between efficiency of three plating media for isolation of Listeria spp., from ground beef

Diferentes meios de plaqueamentos seletivos vêm sendo utilizados no isolamento de bactérias do gênero Listeria. A escolha do meio de cultura em uma análise laboratorial é de suma importância, visto que pode interferir nos resultados obtidos, dificultando o diagnóstico final. A metodologia original do USD prevê a utilização do meio agar LPM no isolamento de Listeria spp., porém, na metodologia revisada, em 1986, este agar foi substituído pelo agar MOX, por ser mais seletivo e facilitar o diagnóstico presuntivo. Neste experimento, comparou-se a eficiência de três ágares de plaqueamento, agar LPM, MMA e MOX no isolamento de Listeria spp. a partir de amostras de carne bovina moída através da metodologia revisada do USDA-FSIS com algumas modificações. De acordo com os resultados, o agar MOX demonstrou-se mais eficiente para o isolamento de L. innocua e L. monocytogenes, sendo que o agar LPM não isolou nenhuma cepa de L. innocua e o agar MMA nenhuma de L. monocytogenes.(AU)

Different selective plating mediums are being used on the isolation of bacterias of the genus Listeria. The bestchoice of the culture medium to laboratory analysis is extremely important, due to the possibility of damage to the obtained results if the medium chosen was not adequate. USDA methodology describes LPM agar on isolation of Listeria spp., but according to the revised methodology, on 1986, LPM agar was substituted for MOX agar, because of being more selective than LPM and makes presuntive diagnosis easier. On this research, three plating mediums efficiency were compared one another on the isolation of Listeria spp. from ground beef samples, using therevised methodology of USDA-FSIS with some modifications. The three mediums were LPM, MMA and MOX agar. According to the results, MOX agar was more effective than the others on isolating L. innocua and L. monocytogenes. LPM agar exhibited no isolation of any L. innocua cepa and MMA agar showed no isolation of L. monocytogenes. (AU)

Assessment of the efficiency of SimPlate™ total plate count color indicator (TPC CI) to quantify mesophilic aerobic microorganisms in pasteurized milk

The SimPlate™ TPC CI system is a rapid method to count mesophilic aerobic microorganisms (MAM) in foods, based on the use of resazurine to indicate bacterial growth. Its efficiency in pasteurized milk was evaluated using 142 pasteurized milk samples (38 type A, 43 type B and 61 type C) collected in Londrina, PR. The standard plating method, using Plate Count Agar (PCA) was used for comparison. The plates of both systems were incubated at 35ºC and read after 24h and 48h. The occurrence of false-positive and false-negative wells and the predominant microorganisms in them were also evaluated. The results were compared by simple correlation and mean variance analyses. The correlation (r) and mean variance values were 0.6811 and 0.7583 for the results obtained after 24h, respectively, and 0.9126 and 0.0842 for the results obtained after 48h, respectively. These results indicate that the performance of the system increases when the plates are incubated for 48h. When the three types of milk were evaluated separately, these values were 0.9285 and 0.0817 for type A milk, 0.9231 and 0.0466 for type B milk and 0.7209 and 0.1082 for type C milk. These results indicate that the better the quality of the milk the better the performance of SimPlate™ TPC CI. False-negative wells, found more frequently in samples with high MAM counts, were caused by Gram positive microorganisms, poorly detected by the SimPlate™ TPC CI system because they grew slowly and had low reduction capacity. The results indicated a higher efficiency of the SimPlate™ TPC CI system in the reading at 48h.

O sistema SimPlate™ TPC CI é um método rápido para enumeração de microrganismos aeróbios mesófilos (MAM) em alimentos que utiliza a resazurina como substância indicadora de crescimento bacteriano. Para avaliar sua eficiência em leite pasteurizado, 142 amostras (38 de leite tipo A, 43 de leite tipo B e 61 de leite tipo C) foram colhidas em Londrina, PR, e analisadas pelo SimPlate™ TPC CI e pelo método de contagem em placas com ágar padrão de contagem (PCA). As placas de ambos os sistemas foram incubadas a 35ºC e as leituras realizadas em 24 e 48h. Também foi verificada a presença de resultados falso-positivos e falso-negativos bem como a microbiota láctea predominante nas cavidades do SimPlate™ TPC CI e a capacidade redutora dos diversos grupos de microrganismos. Os resultados foram comparados através de correlação simples e variância média. Considerando a leitura em 24h do SimPlate™ TPC CI, os resultados obtidos apresentaram uma correlação (r) de 0,6811 (var. média: 0,7583) com os resultados do método padrão; na leitura em 48h, a correlação encontrada entre os dois métodos foi de 0,9126 (var. média: 0,0842). Considerando os diferentes tipos de leite, as leituras em 48h do SimPlate™ TPC CI apresentaram as seguintes correlações com o método padrão: leite tipo A, r: 0,9285 (var. média: 0,0817); leite tipo B, r: 0,9231 (var. média: 0,0466); leite C, r: 0,7209 (var. média: 0,1082). Nas amostras com altas contagens de MAM, verificou-se uma maior freqüência de cavidades falso-negativas e uma grande participação de microrganismos Gram positivos, que são pobremente detectados pelo sistema SimPlate TPC CI por crescerem lentamente e possuírem baixa capacidade redutora. Os resultados indicaram um melhor eficiência do sistema SimPlate™ TPC CI na leitura em 48h, além da influência direta da qualidade do leite analisado, ou seja, quanto melhor a qualidade microbiológica do leite, melhor o desempenho do sistema. A alta correlação entre os métodos indica que o SimPlate™ TPC CI pode ser utilizado como uma alternativa viável ao método padrão de contagem de MAM em leite pasteurizado tipos A e B, desde que a leitura seja realizada em 48h.

Bacteriological examination of feces / Exame bacteriológico de fezes

From the tests made using comparatively the media of enrichment, hyposulfite broth, with the modifications introduced by Shäffer and Kauffmann, and a glycerine solution, the authors verified that the best method of preservation and enrichment is that of glycerine, as this gave 41,1%  positive results, while with the Shäffer"s medium there were obtained only 31,1% positive results. When confronting the glycerine with the Kauffmann"s medium, there were obtained 31,4% positive results for the first and 14,6% for Kauffman"s medium. The glycerine tested comparatively with the Leifson"s Selenite F. enrichment medium gave better results for the isolation of Eberthella typhosa, as there were obtained 12,2% positive results when using the glycerine, while there were found to be only 10,3% positive results for the F. medium. The influence of the temperature was observed when using the glycerine methods, there having been noticed that the temperature of 20C showed better results than that of 37C. A second plating after 24 hours is of great advantage, as this gave an increase of 12,2% in the results obtained. As isolation medium there were used Drigalsky, Endo, the Wilson and Blair"s bismuthe medium, desoxycholate-citrate agar (Leifson), eosin-methylene-blue-agar of Teague and Clurman and the rosolic-acid agar medium recommended by Rangel Pestana an Calazans. The desoxycholate-citrate a

Das experiências feitas comparativamente com os meios de enriquecimento, caldo de hipossulfitos, segundo modificações de Shäffer e Kauffmann e a solução de glicerina, verificaram os autores que o melhor método de preservação e enriquecimento é o da glicerina, pois com este obtiveram 42,1% de resultados positivos, enquanto que com o meio de Shäffer, 31,1%. A glicerina comparada com o meio de Kauffmann deu 31,4% de resultados positivos para a glicerina e 14,5% para o meio de Kauffmann. A glicerina experimentada comparativamente com o meio de selênio F. de Leifson, revelou-se melhor para o isolamento da Eberthella typhosa, pois obtiveram com a glicerina 12,2% de resultados positivos, enquanto que com o meio F. somente 10,3% de resultados positivos. Foi verificado o efeito da temperatura nos métodos de glicerina, tendo sido observado que a temperatura de 20 é melhor que a de 37. Uma segunda semeadura após 24 horas é de grande vantagem, pois verificaram um aumento de 12,2% nos resultados obtidos. Como meio de isolamento foi usado Drigalsky, Endo, o meio de bismuto de Wilson e Blair, ágar desoxicolato de sódio-citrato (Leifson), ágar e eosina e azul de metileno de Teague e Churman e o meio de ágar ácido rosólico, aconselhado por Rangel Pestana e Calazanas. O meio de ágar-desoxicolato-citrato é estudado comparativamente com os meios de ágar-ácido rosólico (Calazanas e Pestana) e ága