The effect of INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions on the structure and biological activity of a G-quadruplex from a critical KRAS G-rich sequence.

Quadruplex-forming oligonucleotides containing INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions have been designed and studied for their capacity to inhibit the expression of the KRAS oncogene in pancreatic adenocarcinoma cells. It is found that INA can influence the folding topology of the G-quadruplex. The oligonucleotides forming the most stable G-quadruplex (ODN-637) is found to exhibit the highest bioactivity.

Nanocrystalline cellulose-fullerene: Novel conjugates.

The covalent grafting of two amino-fullerene C60 derivatives (C60-LC-NH2 and C60-SC-NH2, LC=long chain and SC=short chain) onto the surface of TEMPO oxidized nanocrystalline cellulose (NCC-COOH) has been reported for the first time. These hybrids (NCC-LC-C60 and NCC-SC-C60) form stable colloidal suspensions at concentrations up to 0.5mg/mL and act as effective photosensitizers for singlet oxygen production as demonstrated by the oxidation of L-methionine-methyl ester to the corresponding sulphoxide. Using the same approach, in a one-pot reaction both a fluorescent target molecule (FITC-LC-NH2) and the C60-LC-NH2 derivative have been successfully attached covalently onto the NCC-COOH surface. These hybrids, which showed no cytotoxicity on MCF-7 human breast cancer cells could be good candidates in photodynamic cancer therapy.

Lipid-modified G4-decoy oligonucleotide anchored to nanoparticles: delivery and bioactivity in pancreatic cancer cells.

KRAS is mutated in >90% of pancreatic ductal adenocarcinomas. As its inactivation leads to tumour regression, mutant KRAS is considered an attractive target for anticancer drugs. In this study we report a new delivery strategy for a G4-decoy oligonucleotide that sequesters MAZ, a transcription factor essential for KRAS transcription. It is based on the use of palmitoyl-oleyl-phosphatidylcholine (POPC) liposomes functionalized with lipid-modified G4-decoy oligonucleotides and a lipid-modified cell penetrating TAT peptide. The potency of the strategy in pancreatic cancer cells is demonstrated by cell cytometry, confocal microscopy, clonogenic and qRT-PCR assays.

Charge effect in the interaction of doxorubicin and derivatives with polydeoxynucleotides.

The equilibrium interaction of doxorubicin and its N-acetyl derivative with a series of purine-pyrimidine alternating polydeoxynucleotides has been studied through spectrofluorometry to assess the relevance of the electrostatic contribution to DNA intercalation. The results have shown that: (a) the suppression of the positive charge on the aminosugar has: (I) a profound negative effect on the free energy of intercalation, as expected, and (II) a negligible influence on the base specificity, which supports the notion of an essentially electrostatic effect of N-acetylation on intercalation; (b) a reasonably good accord with the demands of a polyelectrolytic model, due to Friedman and Manning, is found.

Triple helix formation by oligopurine-oligopyrimidine DNA fragments. Electrophoretic and thermodynamic behavior.

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.

A facile duplex-hairpin interconversion through a cruciform intermediate in a linear DNA fragment.

The duplex of d(GGTACGCGCGTGCGCGATGG) and d(CCATCGCGCGTGCGCGTACC) containing an inverted repeat has been studied by spectroscopic and electrophoretic techniques. Prior to melting this DNA fragment, like many other palindromes, transforms into hairpin structures but with four non-self-complementary bases ("dangling ends") at their termini. Most surprisingly, it is found that these dangling ends promote an unusually facile hairpin-duplex interconversion in contrast to very slow ones found in all the "blunt end" palindromes studied so far. Kinetic studies provide evidence, for the first time in a linear DNA fragment, that a cruciform intermediate is involved in the hairpin to duplex interconversion.

Characterization of the DNA triplex formed by d(TGGGTGGGTGGTTGGGTGGG) and a critical R.Y sequence located in the promoter of the murine Ki-ras proto-oncogene.

The binding of the G-rich oligonucleotide d(TGGGTGGGTGGTTGGGTGGG) to a critical homopurine-homopyrimidine sequence located in the promoter of the murine Ki-ras proto-oncogene has been investigated. The duplex and the oligonucleotide form a triple helix as evidenced by band-shift electrophoresis, hydroxyapatite (HA) chromatography, UV-melting and circular dichroism (CD) experiments. Upon thermal denaturation in 50 mM Tris-acetate, pH 7.4, 50 mM NaCl, 10 mM MgCl2, 0.1 mM spermine the triplex exhibits two cooperative transitions: one of these is attributed to the triplex-to-duplex transformation, the other to the duplex-to-coil transformation. The thermodynamic parameters of triplex formation have been determined by a van't Hoff analysis of the UV-melting curves which provided values of delta H = 79 +/- 8 kcal/mol, delta S = 224 +/- 22 e.u., delta G298 = 12.2 +/- 1.2 kcal/mol. These data are compared with those reported for the YRY triplex motif.

Anti-gene strategies to down-regulate gene expression in mammalian cells.

A current goal in molecular medicine is the development of new strategies for the selective inhibition of cancer-critical genes. Triplex-forming oligonucleotides and peptide nucleic acids bind to the double helix of DNA in a sequence-specific manner and with great affinity. Because of these properties, these molecules have been proposed as anti-gene therapeutic drugs. This review summarizes recent results on the use of oligonucleotides and peptide nucleic acids to downregulate gene expression in cultured cells. The data are discussed from the perspective of the recent literature on new molecular strategies with potential therapeutic applications.

Hairpin structures in synthetic oligodeoxynucleotides: sequence effects on the duplex-to-hairpin transition.

We have synthesized and examined a number of fully and partly self-complementary palindromic oligodeoxynucleotides for their ability to assume in solution a unimolecular hairpin structure. The main results obtained by a combined optical and electrophoresis investigation show that: (i) DNA folding needs not be driven by mismatched base pairings over the dyad; fully self-complementary palindromic duplexes, comprising regular (CG)n DNA fragments, possess a considerable intrinsic propensity to make intramolecular base pairings; (ii) The duplex-hairpin interconversion is, in general, a slow process independent of the length and base composition of the palindrome; (iii) The palindromic sequences energetically least favored to form hairpin structures consist of C:G base pairs around the dyad axis and of T:A blocks in the arms of the inverted repeat; (IV) The base composition of the stem strongly influences the hairpin thermal stability. For instance, the substitution of one C:G with one A:T base pair in the stem helix of d(CG)7 diminishes the stability of the hairpin by 9 degrees C. It is found that the stability of the stem helix, in hairpins of defined sequence and with the same loop length, decreases in the order alternating-CG greater than homo-CG greater than AC(GT) greater than alternating-AT, i.e. as in polynucleotides. The thermodynamic parameters for the hairpin-coil transition are reported.

Effect of 5-methylcytosine on the structure and stability of DNA. Formation of triple-stranded concatenamers by overlapping oligonucleotides.

A triple helix can be formed upon binding of a pyrimidine oligonucleotide to the major groove of a homopurine-homopyrimidine (R.Y) double-stranded DNA target site. Here, we report that this reaction can be influenced by base methylation. The pyrimidine strand 5'-TmCTmCTmCTmCTTmCT (mY12), whose cytosine residues are methylated at C5, does not bind the duplex 5'-AGAGAGAGAAGA.3'-TCTCTCTCTTCT (R12.Y12) to yield a 12-triad triplex, as would be expected from these DNA sequences. Rather, a complex of overlapping oligonucleotides, which we define concatenamer, is formed. The concatenamer is clearly evidenced by polyacrylamide gel electrophoresis (PAGE) since it migrates with a smeared band of very low mobility. The stoichiometry of the concatenamer, determined by both UV mixing curves and electrophoresis, is surprisingly found to be (R12.2mY12)n, thus showing that the unmethylated Y12 strand is excluded from the complex. Denaturation experiments performed by ultraviolet absorbance (UV) and differential scanning calorimetry (DSC) show that the concatenamers melt with a single and highly cooperative transition whose Tm strongly depends on pH. Overall, the data point to the conclusion that the concatenamers are in triple helix, where the methylated mY12 strand is engaged in both Watson-Crick and Hoogsteen base pairings, thus displacing the Y12 strand from the R12.Y12 duplex. A possible mechanism of concatenamer formation is proposed. The results presented in this paper show that 5-methylcytosine brings about a strong stabilizing effect on both double and triple DNA helices, and that pyrimidine oligonucleotides containing 5-methylcytosine can displace from R.Y duplexes the analogous non-methylated strand. The advantage of using methylated oligonucleotides in antisense technology is discussed.

The duplex-hairpin conformational transition of d(CGCGCGATCGCGCG) and d(CGCGCGTACGCGCG): a thermodynamic and kinetic study.

We have studied the duplex-hairpin conformational transition in two perfectly palindromic sequences, d(CGCGCGATCGCGCG)(I) and d(CGCGCGTACGCGCG)(II), by means of UV-melting, electrophoretic and T-jump experiments. Both tetradecamers exhibit biphasic thermal profiles. The lower temperature transition is concentration dependent whereas the higher temperature transition is not. The former transition has been characterized by gel electrophoresis and shows two distinct bands, whose intensity depends on temperature. This behavior is due to the occurrence of a slow premelting interconversion between the duplex and hairpin forms in both tetradecamers. The kinetics of hairpin formation from the duplex is studied by T-jump experiments. Relaxation spectra are well reproduced by a single relaxation time with rate constants characterized by a high temperature coefficient. In 10 mM NaCl, the duplex-hairpin conversion of I is characterized by an apparent activation energy of 96 +/- 6 kcal/mol, a value rather close to the expected denaturation enthalpy. In 1 mM NaCl a value slightly lower has been obtained. The rate of duplex-hairpin interconversion has been found to decrease as the salt concentration is raised. These data suggest that the transformation from the duplex to the hairpin form should imply a transition state with a simultaneous breaking of most base pairs, if not total strand separation.

dC-dG alternating oligonucleotides: thermodynamic and kinetic aspects of the B-Z transformation.

The alternating cytosine-guanine oligodeoxyribonucleotides (dCdG)n, (dGdC)n, (dCdG)ndC (n = 3,4), (dGdC)7 and dG(dCdG)3 have been studied by UV and CD spectroscopy at different temperatures and NaCl concentrations. The analysis of the melting data, assuming an all-or-none model, reveals that in the B-conformation the 5'G/C3' stacking interactions are enthalpically favoured with respect to the 5'C/G3' one. The CD investigation of the B-Z equilibrium shows that the Z-conformation is enthalpically stabilized, while the B-conformation is entropically favoured, in the range of NaCl concentration considered (1 to 5 M). The kinetic data for the B-Z transformation, obtained with a salt-jump technique for the hexamer (dCdG)3, support a mechanism by which the Watson-Crick hydrogen bonds are broken before the bases flip over separately and eventually stack, reforming the H-bonds, in the new helix.

The left-handed Z-DNA conformation in oligodeoxynucleotides containing different amounts of AT base pairs: a far UV circular dichroism study.

A number of fully self-complementary oligodeoxynucleotides have been synthesized and examined for their ability to assume the left-handed Z-DNA conformation in high salt solutions. The B- and Z-forms are identified by circular dichroism spectra, covering both the long- (220-300 nm) and short-wavelength (185-220 nm) regions, the latter showing CD bands very useful for identifying the sense of the helix winding. The main results of the study can be summarized as follows: a) sequences composed by AT and CG blocks do support the B to Z transition, even when the AT contents amounts to 50%; b) the occurrence of consecutive purine-purine or pyrimidine-pyrimidine dyads does not inhibit the B to Z transition, although a stronger reduction of water activity is required; c) (AC)n and (GT)n containing oligonucleotides do undergo the B to Z transition in solution; d) a millimolar quantity of Ni2+ concomitant with 5 M NaClO4 is found to be very effective in bringing about the B to Z transition in most of the sequences considered in this study.

The chlorophyll catabolite pheophorbide a as a photosensitizer for the photodynamic therapy.

Pheophorbide a is a clorophyll catabolite that recently has drawn the attention of several investigators for its potential in photodynamic therapy. In this review we summarize its photophysical properties, phototoxicity, cellular localization, biodistribution and PDT activity as a free or conjugated molecule.

Transcription inhibition of oncogenic KRAS by a mutation-selective peptide nucleic acid conjugated to the PKKKRKV nuclear localization signal peptide.

Mutations in the Kirsten ras (KRAS) gene are present in almost all pancreatic adenocarcinomas, and one common mutation is at codon 12: GGT (Gly) is transformed into GAT (Asp). In this work we have targeted the KRAS coding sequence embracing the GAT mutation with a sense PNA molecule (P14), with the aim of downregulating the expression of the mutant allele. P14 was designed with a 15-base sequence complementary to the antisense strand of KRAS at the GAT (Asp) mutation and conjugated to the nuclear localization signal peptide PKKKRKV. CD spectra as a function of temperature show that P14 (2 microM) binds to the antisense strand of the GAT target in the mutated allele with a T(M) of 78 degrees C and to the antisense strand of the GGT target in the wild-type allele with a T(M) of 69 degrees C, in 50 mM Tris-HCl, pH 7.4, and 1 M NaCl. Moreover, P14 showed a high capacity to enter and accumulate in the nuclei of pancreatic cells (Panc-1 and BxPC3), whereas the nonconjugated analogue did not. Quantitative RT-PCR showed that 1 microM P14 was able to specifically suppress KRAS transcription in Panc-1 cells, which harbor mutant KRAS, but not in BxPC3 cells, which contain only wild-type KRAS. However, P14 inhibited KRAS transcription also in BxPC3 cells when used at concentrations of 5 and 10 microM. Following a single PNA treatment, changes in protein level were evident only in Panc-1 cells. As we found that all three genes of the ras family are expressed in the pancreatic cells, we designed PNA-NLS conjugates (P16 and P17) to target also HRAS and NRAS. The binding of each PNA conjugate to the ras genes was assayed by electrophoresis, and their capacity to inhibit transcription was measured by RT-PCR. All of the data obtained, both in vivo and in vitro, are discussed in terms of sequence specificity in the binding between PNA-NLS molecules and genomic DNA.

Kinetic analysis of triple-helix formation by pyrimidine oligodeoxynucleotides and duplex DNA.

The kinetics of triple-helix formation by the pyrimidine oligonucleotide d(CTTTCCTTCTTCTTTCCC) (TFO) and the homopurine.homopyrimidine (R.Y) duplex, whose purine strand is d(TGAAAAAGAAAGGAAGAAAGGG), (D), was studied using ultraviolet absorbance decay measurements, in 50 mM Tris/acetate, pH 6, 50 mM NaCl, 10 mM MgCl2. The decay curves were obtained by a static method, measuring as a function of time the hypochromicity at 270 nm produced by D and TFO after mixing under conditions favorable for triplex formation. This approach allowed direct measurement of triplex formation as it proceeded. The kinetic experiments were carried out at temperatures below the tm of the triplex, i.e. at 17-33 degrees C, and at two different D:TFO ratios, 1:1 and 1:10. When D and TFO were mixed in equimolar amounts, 1.7 microM each, the kinetics of triplex formation were characterized by half-decay times, t1/2, of 150-390 s. By contrast, when TFO was in tenfold excess [14 (mumol TFO).l-1] over D [1.4 (mumol D).l-1], the kinetics were faster and the t1/2 decreased to 19-26 s. Different rate equations have been used to describe the kinetics of triplex formation under these two different conditions. Both sets of experiments provided second-order rate constants, k1, of approximately 10(3) l.(mol TFO)-1.s-1 which showed a slight decrease with temperature. The rate of triplex formation appeared to be about three order of magnitude slower than the rate of duplex recombination, whose rate constant is in the order of 10(6) l.(mol oligomer)-1.s-1 [Craig, M. E., Crother, D. M. & Doty, P. (1971) J. Mol. Biol. 62, 383-401; Pörschke, D. & Eigen, M. (1971) J. Mol. Biol. 62, 361-381; Nelson, J. W. & Tinoco, I, Jr (1982) Biochemistry 21, 5289-5295]. The apparent activation energy associated with the rate constants of triplex formation was small and negative (E1 = -26 +/- 15 kJ/mol). The first-order rate constants of triplex dissociation, k-1, strongly dependent on temperature and were in the range 10(-7) s-1 (at 20 degrees C) to 10(-5) s-1 (at 33 degrees C), with an apparent activation energy that was large and positive (E-1 = 355 +/- 33 kJ/mol). The rate of triplex formation also showed a significant dependence on the ionic strength (I) of the buffer solution. A decrease of I from 130 M to 57 M resulted in a sixfold decrease of the association constant, from 2.16 x 10(3) to 0.36 x 10(3) l.(mol TFO)-1.s-1, at 22.5 degrees C.(ABSTRACT TRUNCATED AT 400 WORDS)

Evidence for intramolecularly folded i-DNA structures in biologically relevant CCC-repeat sequences.

The structural behaviour of repetitive cytosine DNA is examined in the oligodeoxynucleotide sequences of (CCCTAA)3CCCT (HTC4), GC(TCCC)3TCCT(TCCC)3 (KRC6) and the methylated (CCCT)3TCCT(CCCT)3C (KRM6) by circular dichroism (CD), gel electrophoresis (PAGE), and ultra violet (UV) absorbance studies. All the three sequences exhibit a pH-induced cooperative structural transition as monitored by CD. An intense positive CD band around 285 nm develops on lowering the pH from 8 to slightly acidic condition, indicative of the formation of base pairs between protonated cytosines. The oligomers are found to melt in a fully reversible and cooperative fashion, with a melting temperature (Tm) of around 50 degrees C at pH 5.5. The melting temperatures are independent from DNA concentration, indicative of an intramolecular process involved in the structural formation. PAGE experiments performed with 32P-labeled samples as well as with normal staining procedures show a predominantly single band migration for all the three oligomers suggestive of a unimolecular structure. From pH titrations the number of protons required for generating the structures formed by HTC4, KRC6 and KRM6 results to be around six. These findings strongly suggest that all the three sequences adopt an intramolecular i-motif structure. The demonstration of i-motif structure for KRC6, a critical functional stretch of the c-ki-ras promoter proto-oncogene, besides the human telomeric sequence HTC4, may be suggestive of larger significance in the functioning of DNA.

Base specificity in the interaction of ethidium with synthetic polyribonucleotides.

Base specificity in the interaction of ethidium with double stranded synthetic RNA homopolymers has been studied by means of spectroscopic (UV-visible absorption and fluorescence), microcalorimetric and dilatometric techniques. The results show a strong base specificity in this interaction, the association constant with poly A:poly U being more than three order of magnitude higher than with poly O:poly C. The interaction is mainly enthalpy driven, the differences in affinity being essentially entropic in origin. These evidences along with the dilatometric data suggest that the observed base specificity may arise from the different extent of water release upon intercalation.