Analysis of ion transport properties of Glycine max HKT transporters and identifying a regulation of GmHKT1;1 by the non-functional GmHKT1;4.

The HKT transporter plays an important role for plants in response to salt stress, but the transport property of the soybean HKT transporters at the molecular level is still unclear. Here, using Xenopus oocyte as a heterologous expression system and two-electrode voltage-clamp technique, we identified four HKT transporters, GmHKT1;1, GmHKT1;2, GmHKT1;3, and GmHKT1;4, which all belong to type I subfamily, but having distinct ion transport properties. While GmHKT1;1, GmHKT1;2 and GmHKT1;3 function as Na+ transporters, GmHKT1;1 is less selective against K+ than the two other transporters. Astonishingly, GmHKT1;4, which lacks transmembrane segments and has no ion permeability, is significantly expressed, and its gene expression pattern is different from the other three GmHKTs under salt stress. Interestingly, GmHKT1;4 reduced the Na+/K+ currents mediated by GmHKT1;1. Further study showed that the transport ability of GmHKT1;1 regulated by GmHKT1;4 was related to the structural differences in the first intracellular domain and the fourth repeat domain. Overall, we have identified one unique GmHKT member, GmHKT1;4, which modulates the Na+ and K+ transport ability of GmHKT1;1 via direct interaction. Thus, we have revealed a new type of HKTs interaction model for altering their ion transport properties.

High positive predictive value of CNVs detected by clinical exome sequencing in suspected genetic diseases.

BACKGROUND: Genetic disorders often manifest as abnormal fetal or childhood development. Copy number variations (CNVs) represent a significant genetic mechanism underlying such disorders. Despite their importance, the effectiveness of clinical exome sequencing (CES) in detecting CNVs, particularly small ones, remains incompletely understood. We aimed to evaluate the detection of both large and small CNVs using CES in a substantial clinical cohort, including parent-offspring trios and proband only analysis. METHODS: We conducted a retrospective analysis of CES data from 2428 families, collected from 2018 to 2021. Detected CNV were categorized as large or small, and various validation techniques including chromosome microarray (CMA), Multiplex ligation-dependent probe amplification assay (MLPA), and/or PCR-based methods, were employed for cross-validation. RESULTS: Our CNV discovery pipeline identified 171 CNV events in 154 cases, resulting in an overall detection rate of 6.3%. Validation was performed on 113 CNVs from 103 cases to assess CES reliability. The overall concordance rate between CES and other validation methods was 88.49% (100/113). Specifically, CES demonstrated complete consistency in detecting large CNV. However, for small CNVs, consistency rates were 81.08% (30/37) for deletions and 73.91% (17/23) for duplications. CONCLUSION: CES demonstrated high sensitivity and reliability in CNV detection. It emerges as an economical and dependable option for the clinical CNV detection in cases of developmental abnormalities, especially fetal structural abnormalities.

Amide proton transfer MRI at 9.4 T for differentiating tissue acidosis in a rodent model of ischemic stroke.

PURPOSE: Differentiating ischemic brain damage is critical for decision making in acute stroke treatment for better outcomes. We examined the sensitivity of amide proton transfer (APT) MRI, a pH-weighted imaging technique, to achieve this differentiation. METHODS: In a rat stroke model, the ischemic core, oligemia, and the infarct-growth region (IGR) were identified by tracking the progression of the lesions. APT MRI signals were measured alongside ADC, T1, and T2 maps to evaluate their sensitivity in distinguishing ischemic tissues. Additionally, stroke under hyperglycemic conditions was studied. RESULTS: The APT signal in the IGR decreased by about 10% shortly after stroke onset, and further decreased to 35% at 5 h, indicating a progression from mild to severe acidosis as the lesion evolved into infarction. Although ADC, T1, and T2 contrasts can only detect significant differences between the IGR and oligemia for a portion of the stroke duration, APT contrast consistently differentiates between them at all time points. However, the contrast to variation ratio at 1 h is only about 20% of the contrast to variation ratio between the core and normal tissues, indicating limited sensitivity. In the ischemic core, the APT signal decreases to about 45% and 33% of normal tissue level at 1 h for the normoglycemic and hyperglycemic groups, respectively, confirming more severe acidosis under hyperglycemia. CONCLUSION: The sensitivity of APT MRI is high in detecting severe acidosis of the ischemic core but is much lower in detecting mild acidosis, which may affect the accuracy of differentiation between the IGR and oligemia.

Identification of four novel large deletions and complex variants in the α-globin locus in Chinese population.

BACKGROUND: At present, the methods generally used to detect α-thalassemia mutations are confined to detecting common mutations, which may lead to misdiagnosis or missed diagnosis. The single-molecule real-time (SMRT) sequencing enables long-read single-molecule sequencing with high detection accuracy, and long-length DNA chain reads in high-fidelity read mode. This study aimed to identify novel large deletions and complex variants in the α-globin locus in Chinese population. METHODS: We used SMRT sequencing to detect rare and complex variants in the α-globin locus in four individuals whose hematological data indicated microcytic hypochromic anemia. However, the conventional thalassemia detection result was negative. Multiplex ligation-dependent probe amplification and droplet digital polymerase chain reaction were used to confirm SMRT sequencing results. RESULTS: Four novel large deletions were observed ranging from 23 to 81 kb in the α-globin locus. One patient also had a duplication of upstream of HBZ in the deletional region, while another, with a 27.31-kb deletion on chromosome 16 (hg 38), had abnormal hemoglobin Siriraj (Hb Siriraj). CONCLUSION: We first identified the four novel deletions in the α-globin locus using SMRT sequencing. Considering that the conventional methods might lead to misdiagnosis or missed diagnosis, SMRT sequencing proved to be an excellent method to discover rare and complex variants in thalassemia, especially in prenatal diagnosis.

Two novel deletion mutations in ß-globin gene cause ß-thalassemia trait in two Chinese families.

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Probiotic Bifidobacterium animalis ssp. lactis Probio-M8 improves the fermentation and probiotic properties of fermented milk.

Probiotics are increasingly used as starter cultures to produce fermented dairy products; however, few studies have investigated the role of probiotics in milk fermentation metabolism. The current study aimed to investigate whether adding Bifidobacterium animalis ssp. lactis Probio-M8 (Probio-M8) as a starter culture strain could improve milk fermentation by comparing the physico-chemical characteristics and metabolomes of fermented milks produced by a commercial starter culture with and without Probio-M8. Our results showed that adding Probio-M8 shortened the milk fermentation time and improved the fermented milk texture and stability. Metabolomics analyses revealed that adding Probio-M8 affected mostly organic acid, amino acid, and fatty acid metabolism in milk fermentation. Targeted quantitative analyses revealed significant increases in various metabolites related to the sensory quality, nutritive value, and health benefits of the probiotic fermented milk, including 5 organic acids (acetic acid, lactic acid, citric acid, succinic acid, and tartaric acid), 5 essential amino acids (valine, arginine, leucine, isoleucine, and lysine), glutamic acid, and 2 essential fatty acids (α-linolenic acid and docosahexaenoic acid). Thus, applying probiotics in milk fermentation is desirable. This study has generated useful information for developing novel functional dairy products.

In silico analysis of NAC gene family in the mangrove plant Avicennia marina provides clues for adaptation to intertidal habitats.

NAC (NAM, ATAF1/2, CUC2) transcription factors (TFs) constitute a plant-specific gene family. It is reported that NAC TFs play important roles in plant growth and developmental processes and in response to biotic/abiotic stresses. Nevertheless, little information is known about the functional and evolutionary characteristics of NAC TFs in mangrove plants, a group of species adapting coastal intertidal habitats. Thus, we conducted a comprehensive investigation for NAC TFs in Avicennia marina, one pioneer species of mangrove plants. We totally identified 142 NAC TFs from the genome of A. marina. Combined with NAC proteins having been functionally characterized in other organisms, we built a phylogenetic tree to infer the function of NAC TFs in A. marina. Gene structure and motif sequence analyses suggest the sequence conservation and transcription regulatory regions-mediated functional diversity. Whole-genome duplication serves as the driver force to the evolution of NAC gene family. Moreover, two pairs of NAC genes were identified as positively selected genes of which AmNAC010/040 may be imposed on less constraint toward neofunctionalization. Quite a few stress/hormone-related responsive elements were found in promoter regions indicating potential response to various external factors. Transcriptome data revealed some NAC TFs were involved in pneumatophore and leaf salt gland development and response to salt, flooding and Cd stresses. Gene co-expression analysis found a few NAC TFs participates in the special biological processes concerned with adaptation to intertidal environment. In summary, this study provides detailed functional and evolutionary information about NAC gene family in mangrove plant A. marina and new perspective for adaptation to intertidal habitats.

Hydrogen sulfide upregulates the alternative respiratory pathway in mangrove plant Avicennia marina to attenuate waterlogging-induced oxidative stress and mitochondrial damage in a calcium-dependent manner.

Hydrogen sulfide (H2 S) is considered to mediate plant growth and development. However, whether H2 S regulates the adaptation of mangrove plant to intertidal flooding habitats is not well understood. In this study, sodium hydrosulfide (NaHS) was used as an H2 S donor to investigate the effect of H2 S on the responses of mangrove plant Avicennia marina to waterlogging. The results showed that 24-h waterlogging increased reactive oxygen species (ROS) and cell death in roots. Excessive mitochondrial ROS accumulation is highly oxidative and leads to mitochondrial structural and functional damage. However, the application of NaHS counteracted the oxidative damage caused by waterlogging. The mitochondrial ROS production was reduced by H2 S through increasing the expressions of the alternative oxidase genes and increasing the proportion of alternative respiratory pathway in the total mitochondrial respiration. Secondly, H2 S enhanced the capacity of the antioxidant system. Meanwhile, H2 S induced Ca2+ influx and activated the expression of intracellular Ca2+ -sensing-related genes. In addition, the alleviating effect of H2 S on waterlogging can be reversed by Ca2+ chelator and Ca2+ channel blockers. In conclusion, this study provides the first evidence to explain the role of H2 S in waterlogging adaptation in mangrove plants from the mitochondrial aspect.

Creating perfect composite vortex beams with a single all-dielectric geometric metasurface: erratum.

Erratum to "Creating perfect composite vortex beams with a single all-dielectric geometric metasurface." [Opt. Express30, 40231 (2022)10.1364/OE.475158]. Here are some mistakes in the paper, which needs to be revised.

Metasurface-based perfect vortex beams with trigonometric-function topological charge for OAM manipulation.

Topological charge (TC) is generally acknowledged as an important attribute of an optical vortex (OV), which indicates the twisted characterization of the wavefront. In most circumstances, the TC remains constant as an integer or fraction along the azimuthal direction. Herein, by transforming the TCs into the trigonometric functions of the azimuthal angle to tailor the spiral phase distributions, we numerically demonstrate generating perfect vortex beams (PVBs) with sine-function TC based on the all-dielectric geometric metasurfaces, whose unit structure is optimized to an ideal half-wave plate. To seek the intrinsic advancements of the proposed PVBs, their orbital angular momentum (OAM) as well as optical gradient force distributions are calculated for diverse particle manipulation. We believe our proposed scheme is desired to provide an original thought for OAM manipulation, information storage, and optical communication.

Role of opioid and ß-adrenergic receptors in bladder underactivity induced by prolonged pudendal nerve stimulation in cats.

AIMS: To determine the role of opioid and ß-adrenergic receptors in bladder underactivity induced by prolonged pudendal nerve stimulation (PNS). METHODS: In α-chloralose anesthetized cats, 30-min PNS was applied repeatedly for 3-9 times to induce poststimulation or persistent bladder underactivity. Then, naloxone (opioid receptor antagonist, 1 mg/kg, IV) or propranolol (ß-adrenergic receptor antagonist, 3 mg/kg, IV) was given to reverse the bladder underactivity. After the drug treatment, an additional 30-min PNS was applied to counteract the drug effect. Repeated cystometrograms were performed by slowly (1-2 mL/min) infusing the bladder with saline via a urethral catheter to determine the bladder underactivity and the treatment effects. RESULTS: Prolonged (2-4.5 h) PNS induced bladder underactivity evident as a large bladder capacity (169 ± 49% of control) and a reduced amplitude of bladder contraction (59 ± 17% of control). Naloxone fully reversed the bladder underactivity by reducing bladder capacity to 113 ± 58% and increasing the amplitude of bladder contraction to 104 ± 34%. After administration of naloxone an additional 30-min PNS temporarily increased the bladder capacity to the underactive bladder level (193 ± 74%) without changing the amplitude of the bladder contraction. Propranolol had no effect on bladder underactivity. CONCLUSIONS: A tonic enkephalinergic inhibitory mechanism in the CNS plays a critical role in the bladder underactivity induced by prolonged PNS, while the peripheral ß-adrenergic receptor mechanism in the detrusor is not involved. This study provides basic science evidence consistent with the clinical observation that comorbid opioid usage may contribute to voiding dysfunction in patients with Fowler's syndrome.

Efficient dynamic tunable metasurface based on Ge2Sb2Te5 in the near infrared band.

For effective wavefront management in the optical infrared range, dynamic all-dielectric metasurfaces, always based on phase transition materials, particularly G e 2 S b 2 T e 5 (GST), can be used. In this paper, we propose a GST-based tunable metasurface by structuring the phase-change material GST. We confirm that the nanopillar we designed has high transmittance in the wavelength band around 1550 nm and can fully cover the 0∼2π phase. Based on these characteristics, we can achieve beam steering and a focusing effect in amorphous phase by elaborately arranging GST nanopillars, while the aforementioned optical phenomena disappear in crystalline phase. Additionally, by arranging the array of vortex phases, we also realize switching the perfect composite vortex beam (PCVB) when changing the crystal state of GST, and simulate the generation of PCVB with different topological charges and sizes in amorphous phase. We believe that our research results can serve as a reference for multifunctional optical surfaces, dynamic optical control, optical communication, and information processing.

Comparison of volatile metabolic profiles in fermented milk of Streptococcus thermophilus during the postripening period at different incubation temperatures.

Streptococcus thermophilus has been extensively applied in fermented milk. This study used gas chromatography-ion mobility spectroscopy to determine and evaluate the volatile metabolites in raw milk, milk fermented at 37°C, and milk fermented at 42°C. Ten discriminatory volatile metabolites were identified at different incubation temperatures: acetone, 2-heptanone, 2-pentanone, 2-hexanone, butanal, hexanal, ethyl acetate, 3-methylbutanal, 3-methylbutanoic acid, and 2-methylpropanoic acid, indicating that fermentation temperature affected the spectrum of volatiles in milk fermented by different strains of S. thermophilus. Specifically, fermentation at 37°C led to accumulation of short-chain fatty acids, whereas fermentation at 42°C enriched ketones and other flavor substances in the fermented milk, enhancing the flavor of the product. This work examined the differences between the volatile metabolites produced by different S. thermophilus strains fermented at different temperatures to evaluate the effect of temperature on the metabolic pathways.

Complete Genome Sequence of Pantoea ananatis Strain LCFJ-001 Isolated from Bacterial Wilt Mulberry.

A Pantoea ananatis strain, named LCFJ-001 (GDMCC: 1.6101), was isolated for the first time from bacterial wilt-diseased roots of mulberry (Morus atropurpurea) in the western part of the Guangxi Zhuang Autonomous Region, China. Moreover, through Koch's postulates, it was proven that LCFJ-001 can cause mulberry wilt, which is one of the pathogens of mulberry bacterial wilt. Here, we report a complete, annotated genome sequence of P. ananatis LCFJ-001. The entire genome sequence of P. ananatis strain LCFJ-001 was a 4,499,350 bp circular chromosome with 53.50% GC content. In total, 3,521 genes were annotated, of which 3,418 were assigned protein-coding genes. In addition, 22 ribosomal RNAs and 81 transfer RNAs were identified. The presented resource will help explore the pathogenetic mechanisms of mulberry wilt disease caused by the genus Pantoea.

Mechanisms Underlying Poststimulation Block Induced by High-Frequency Biphasic Stimulation.

OBJECTIVE: To reveal the possible mechanisms underlying poststimulation block induced by high-frequency biphasic stimulation (HFBS). MATERIALS AND METHODS: A new axonal conduction model is developed for unmyelinated axons. This new model is different from the classical axonal conduction model by including both ion concentrations and membrane ion pumps to allow analysis of axonal responses to long-duration stimulation. Using the new model, the post-HFBS block phenomenon reported in animal studies is simulated and analyzed for a wide range of stimulation frequencies (100 Hz-10 kHz). RESULTS: HFBS can significantly change the Na+ and K+ concentrations inside and outside the axon to produce a post-HFBS block of either short-duration (<500 msec) or long-duration (>3 sec) depending on the duration of HFBS. The short-duration block is due to the fast recovery of the Na+ and K+ concentrations outside the axon in periaxonal space by diffusion of ions into and from the large extracellular space, while the long-duration block is due to the slow restoration of the normal Na+ concentration inside the axon by membrane ion pumps. The 100 Hz HFBS requires the minimal electrical energy to achieve the post-HFBS block, while the 10 kHz stimulation is the least effective frequency requiring high intensity and long duration to achieve the block. CONCLUSION: This study reveals two possible ionic mechanisms underlying post-HFBS block of axonal conduction. Understanding these mechanisms is important for improving clinical applications of HFBS block and for developing new nerve block methods employing HFBS.

Temperature Effect on Nerve Conduction Block Induced by High-Frequency (kHz) Biphasic Stimulation.

OBJECTIVES: This study aims to determine temperature effect on nerve conduction block induced by high-frequency (kHz) biphasic stimulation (HFBS). MATERIALS AND METHODS: Frog sciatic nerve-muscle preparation was immersed in Ringer's solution at a temperature of 15 or 20 °C. To induce muscle contractions, a bipolar cuff electrode delivered low-frequency (0.25 Hz) stimulation to the nerve. To induce nerve block, a tripolar cuff electrode was placed distal to the bipolar cuff electrode to deliver HFBS (2 or 10 kHz). A bipolar hook electrode distal to the blocking electrode was used to confirm that the nerve block occurred locally at the site of HFBS. A thread tied onto the foot was attached to a force transducer to measure the muscle contraction force. RESULTS: At 15 °C, both 2- and 10-kHz HFBSs elicited an initial transient muscle contraction and then produced nerve block during the stimulation (ie, acute block), with the 10 kHz having a significantly (p < 0.001) higher acute block threshold (5.9 ± 0.8 mA peak amplitude) than the 2 kHz (1.9 ± 0.3 mA). When the temperature was increased to 20 °C, the acute block threshold for the 10-kHz HFBS was significantly (p < 0.0001) decreased from 5.2 ± 0.3 to 4.4 ± 0.2 mA, whereas the 2-kHz HFBS induced a tonic muscle contraction during the stimulation but elicited nerve block after terminating the 2-kHz HFBS (ie, poststimulation block) with an increased block duration at a higher stimulation intensity. CONCLUSION: Temperature has an important influence on HFBS-induced nerve block. The blocking mechanisms underlying acute and poststimulation nerve blocks are likely to be very different.

Penile Erection Induced by Stimulation of Sacral S1/S2 Spinal Root in Cats.

OBJECTIVE: This study aimed at determining whether stimulation of sacral spinal roots can induce penile erection in cats. MATERIALS AND METHODS: In anesthetized cats, a 20-gauge catheter was inserted into the corpus cavernosum to measure the penile pressure. Stimulus pulses (5-80 Hz, 0.2 ms) were applied through bipolar hook electrodes to sacral ventral roots alone or to combined ventral and dorsal roots of a single S1-S3 segment to induce penile pressure increases and penile erection. RESULTS: Stimulation of the S1 or S2 ventral root at 30 to 40 Hz induced observable penile erection with rigidity and the largest increase (169 ± 11 cmH2O) in penile pressure. Continuous stimulation (10 minutes) of afferent and efferent axons by simultaneous stimulation of the S1 or S2 dorsal and ventral roots at 30 Hz also produced a large increase (190 ± 8 cmH2O) in penile pressure that was sustainable during the entire stimulation period. After a complete spinal cord transection at the T9-T10 level, simultaneous stimulation of the S1 or S2 dorsal and ventral roots induced large (186 ± 9 cmH2O) and sustainable increases in penile pressure. CONCLUSION: This study indicates the possibility to develop a novel neuromodulation device to restore penile erection after spinal cord injury using a minimally invasive surgical approach to insert a lead electrode through the sacral foramen to stimulate a sacral spinal root.

Pudendal Nerve Block by Adaptively Stepwise Increasing the Intensity of High-Frequency (10 kHz) Biphasic Stimulation.

OBJECTIVE: The purpose of this study is to determine whether adaptively stepwise increasing the intensity of a high-frequency (10 kHz) biphasic stimulation (HFBS) can produce nerve conduction block without generating a large initial response. MATERIALS AND METHODS: In anesthetized cats, three cuff electrodes were implanted on the left pudendal nerve for stimulation or block. The urethral pressure increase induced by pudendal nerve stimulation was used to measure the pudendal nerve block induced by HFBS. RESULTS: HFBS applied suddenly with a large step increase in intensity induced a large (86 ± 16 cmH2O) urethral pressure increase before it blocked pudendal nerve conduction. However, HFBS applied by adaptively stepwise increasing the intensity every 10 to 60 seconds over a long period (33-301 minutes; average 108 ± 35 minutes) with many small intensity increases (0.005-0.1 mA) induced no response or low-amplitude high-frequency urethral pressure changes before it blocked pudendal nerve conduction. The minimal HFBS intensities required by the two different methods to block pudendal nerve conduction are similar. CONCLUSION: This study is important for better understanding the possible mechanisms underlying the HFBS-induced nerve block and provides the possibility of developing a new nerve block method for clinical applications in which an initial large response is a concern.

Sacral neuromodulation of bladder underactivity induced by prolonged pudendal afferent firing in cats.

This study examined the effect of sacral neuromodulation on persistent bladder underactivity induced by prolonged pudendal nerve stimulation (PudNS). In 10 α-chloralose-anesthetized cats, repetitive application of 30-min PudNS induced bladder underactivity evident as an increase in bladder capacity during a cystometrogram (CMG). S1 or S2 dorsal root stimulation (15 or 30 Hz) at 1 or 1.5 times threshold intensity (T) for inducing reflex hindlimb movement (S1) or anal sphincter twitch (S2) was applied during a CMG to determine if the stimulation can reverse the bladder underactivity. Persistent (>3 h) bladder underactivity consisting of a significant increase in bladder capacity to 163.1 ± 11.3% of control was induced after repetitive (1-10 times) application of 30-min PudNS. S2 but not S1 dorsal root stimulation at 15 Hz and 1 T intensity reversed the PudNS-induced bladder underactivity by significantly reducing the large bladder capacity to 124.3 ± 12.9% of control. Other stimulation parameters were not effective. After the induction of persistent underactivity, recordings of reflex bladder activity under isovolumetric conditions revealed that S2 dorsal root stimulation consistently induced the largest bladder contraction at 15 Hz and 1 T when compared with other frequencies (5-40 Hz) or intensities (0.25-1.5 T). This study provides basic science evidence consistent with the hypothesis that abnormal pudendal afferent activity contributes to the bladder underactivity in Fowler's syndrome and that sacral neuromodulation treats this disorder by reversing the bladder inhibition induced by pudendal nerve afferent activity.

Superficial peroneal neuromodulation of nonobstructive urinary retention induced by prolonged pudendal afferent activity in cats.

The purpose of this study is to determine whether superficial peroneal nerve stimulation (SPNS) can improve nonobstructive urinary retention (NOUR) induced by prolonged pudendal nerve stimulation (PNS). In this exploratory acute study using eight cats under anesthesia, PNS and SPNS were applied by nerve cuff electrodes. Skin surface electrodes were also used for SPNS. A double lumen catheter was inserted via the bladder dome for bladder infusion and pressure measurement and to allow voiding without a physical urethral outlet obstruction. The voided and postvoid residual (PVR) volumes were also recorded. NOUR induced by repetitive (4-13 times) application of 30-min PNS significantly (P < 0.05) reduced voiding efficiency by 49.5 ± 16.8% of control (78.3 ± 7.9%), with a large PVR volume at 208.2 ± 82.6% of control bladder capacity. SPNS (1 Hz, 0.2 ms) at 1.5-2 times threshold intensity (T) for inducing posterior thigh muscle contractions was applied either continuously (SPNSc) or intermittently (SPNSi) during cystometrograms to improve the PNS-induced NOUR. SPNSc and SPNSi applied by nerve cuff electrodes significantly (P < 0.05) increased voiding efficiency to 74.5 ± 18.9% and 67.0 ± 15.3%, respectively, and reduced PVR volume to 54.5 ± 39.0% and 88.3 ± 56.0%, respectively. SPNSc and SPNSi applied noninvasively by skin surface electrodes also improved NOUR similar to the stimulation applied by a cuff electrode. This study indicates that abnormal pudendal afferent activity could be a pathophysiological cause for the NOUR occurring in Fowler's syndrome and a noninvasive superficial peroneal neuromodulation therapy might be developed to treat NOUR in patients with Fowler's syndrome.