Clinical and mutational characteristics of oculocutaneous albinism type 7.

The purpose of this paper is to expand on the phenotype of oculocutaneous albinism type 7 (OCA7). We described three patients with OCA7: two from a consanguineous family of Kurdish origin and one patient of Dutch origin. We compared them with all patients described to date in the literature. All newly described patients had severely reduced visual acuity (VA), nystagmus, hypopigmentation of the fundus, severe foveal hypoplasia, and chiasmal misrouting. None had iris translucency. All patients had normal pigmentation of skin and hair. We found one novel mutation in the Dutch patient: c.565G > A; p.(Gly189Ser). We compared our patients to the 15 described in the literature to date. All 18 patients had substantially pigmented skin and hair, very poor VA (0.4-1.3 logMAR), nystagmus, (mild) ocular hypopigmentation, foveal hypoplasia, and misrouting. Although pigmentation levels were mildly affected in OCA7, patients had a severe ocular phenotype with VA at the poorer end of the albinism spectrum, severe foveal hypoplasia, and chiasmal misrouting. OCA7 patients had a phenotype restricted to the eyes, and similar to that of X-linked ocular albinism. We therefore propose to rename the disorder in ocular albinism type 2. Unfolding the role of LRMDA in OCA7, may bring us a step closer in identifying the responsible factors for the co-occurrence of foveal hypoplasia and misrouting.

Case series: Fundus autofluorescence abnormalities in a family of ocular albinism carriers.

SIGNIFICANCE: Carriers of ocular albinism demonstrate signs of retinal mosaicism with unique features on fundus autofluorescence testing, which differentiate this condition from other x-linked retinal disorders in carrier patients. Distinctive findings include a mud-splattered fundus with peripheral hyperpigmented streaks, which correlate with areas of hyperautofluorescence and hypoautofluorescence. PURPOSE: This is the first reported case series of a family that demonstrates diagnostic retinal and fundus autofluorescence abnormalities related to retinal mosaicism in three sisters who were unaware they were carriers of ocular albinism type 1. Multimodal imaging, electrodiagnostic testing, and genetic testing can be used to confirm the diagnosis and differentiate this clinical presentation from other sight-threatening hereditary retinal diseases. CASE REPORTS: Three sisters, aged 21, 17, and 13 years, were referred to determine the cause of abnormal retinal pigmentation. All presented with normal vision, and anterior segment examination was unremarkable without iris transillumination. They denied family history of ocular disease. Fundus examination of all three sisters revealed a mud-splattered pattern of pigmentation in the posterior pole and radial pigmentary streaks. Fundus autofluorescence showed a pattern of hyperautofluorescence and hypoautofluorescence corresponding to this pigmentary pattern. Spectral domain optical coherence tomography, electro-oculogram, and electroretinogram were normal in all three sisters. Genetic testing of their father, who was unaware of any disorder, tested positive for ocular albinism. CONCLUSIONS: Ocular albinism carriers have abnormal retinal pigmentation in a characteristic pattern. Fundus autofluorescence shows a correlative pattern that can confirm carrier status of ocular albinism in individuals unaware of their status and rule out other retinal degenerations.

Novel Variants of HPS6 Cause Suspected Ocular Albinism: A Report of 2 Cases and the Profile of HPS6 Variants.

INTRODUCTION: Hermansky-Pudlak syndrome (HPS) is a rare autosomal-recessive disease characterized by ocular albinism (OA) or oculocutaneous albinism (OCA), platelet dysfunction, and other symptoms. This study aimed to analyze the molecular defect in two Chinese families with suspected OA, as well as to investigate the profile of HPS6 variants and their genotype-phenotype correlations. METHODS: Seven members from two families were recruited and underwent clinical ophthalmologic examinations. The genomic DNA was extracted from peripheral blood leukocytes. Whole-exome sequencing was performed on the proband of family JX. The single coding exon of HPS6 was directly Sanger sequenced based on PCR amplification in all available family members. An additional 46 probands from families or sporadic cases with the pathogenic variants of HPS6 reported in the literature were reviewed. RESULTS: We identified two different compound heterozygous truncating variants of HPS6 in probands with suspected OA from two independent families. The proband of family JX had c.1674dup and c.503-504del variants, and the other proband from family CZ had a nonsense variant of c.1114C>T and a frameshift variant of c.1556del. Among them, c.1674dup and c.1556del variants in HPS6 have not been reported previously. Therefore, our patients were diagnosed as HPS6 disease by molecular diagnostics. In the retrospective cohort of HPS6 patients, we delineated the profile of HPS6 variants and revealed a significant overlap between CpG islands and the variants of HPS6, suggesting a potential link between DNA methylation and HPS6 variants. We also observed a spatial aggregation of the variants in 3D structure of HPS6 protein, implying the possible functional significance of these structural regions. In addition, we did not find any significant genotype-phenotype correlation of HPS6, and neither did we observe a correlation between the truncation length of the HPS6 protein and the phenotype of HPS6 disease. CONCLUSION: Our research expands the spectrum of HPS6 variants, providing a comprehensive delineation of their profile and systematically investigating genotype-phenotype correlations in HPS6. These findings could offer potentially valuable clues for investigating the molecular mechanism underlying HPS6 pathogenesis, as well as aiding the clinical diagnosis of HPS6 patients and improving disease prognosis.

Determining a Worldwide Prevalence of Oculocutaneous Albinism: A Systematic Review.

Purpose: The aim of this systematic review was to investigate the available data on the epidemiology of oculocutaneous albinism (OCA) around the world, and to determine whether a generalizable, worldwide prevalence figure could be proposed. Methods: Extensive literature search strategies were conducted, interrogating PubMed, Scopus, and Web of Science, to locate relevant literature. Ultimately 34 studies reporting original data were included for analysis. Results: Findings showed that most data were outdated, and only 6 of 34 articles (18%) were published after 2010. There were few good studies with sound methodology and large, clearly defined population samples. Only a small proportion of countries worldwide (26/193 [13%]) have produced prevalence figures for OCA. By continent, African studies were disproportionately represented (15/34 [44%]). The highest prevalence rates (range, 1 in 22 to 1 in 1300; mean, 1 in 464) were reported in population isolates. The mean prevalence from four African countries was 1 in 4264 (range, 1 in 1755 to 1 in 7900). Prevalence for three countries in Europe (mean, 1 in 12,000; range, 1 in 10,000 to 1 in 15,000) may be underestimated, as the phenotype, in fair-skinned populations, may be missed or misdiagnosed as ocular albinism or isolated visual impairment. Population rates may vary depending on local cultural factors (e.g., consanguineous matings) and may change over time. Conclusions: The prevalence of OCA varies widely between continents and population groups, and it is often influenced by local factors. It was not possible, therefore, to determine a single, generalizable worldwide prevalence rate for OCA, although continental rates for Africa and Europe are useful.

Diagnostic Yield of Genetic Testing for Ocular and Oculocutaneous Albinism in a Diverse United States Pediatric Population.

The diagnostic yield of genetic testing for ocular/oculocutaneous albinism (OA/OCA) in a diverse pediatric population in the United States (U.S.) is unclear. Phenotypes of 53 patients who presented between 2006-2022 with OA/OCA were retrospectively correlated with genetic testing results. Genetic diagnostic yield was defined as detection of pathogenic/likely pathogenic variant(s) matching the anticipated inheritance for that gene-disease relationship. Variant reclassifications of those with variants of uncertain significance (VUS) and without positive diagnostic yield were completed. Overall initial genetic diagnostic yield of OA/OCA was 66%. There was no significant difference (p = 0.59) between race and ethnicities (Black (78%), White (59%), Hispanic/Latino (64%)); however, the diagnostic yield of OA (33%) was significantly lower (p = 0.007) than OCA (76%). Causative variants in OCA2 (28%) and TYR (20%) were most common. Further, Hermansky-Pudlak syndrome variants were identified in 9% of patients. Re-classification of VUS in non-diagnostic cases resulted in genetic diagnoses for 29% of individuals and increased overall diagnostic yield to 70% of all subjects. There is a high diagnostic yield of genetic testing of patients overall with OA/OCA in a diverse U.S. based pediatric population. Presence or absence of cutaneous involvement of albinism significantly affects genetic diagnostic yield.

Ocular findings and a comparative study of hair, skin and iris color in Chinese patients with albinism.

BACKGROUND: Oculocutaneous albinism (OCA) could be either non-syndromic or syndromic. There are significant challenges in clinically recognizing and differentiating Hermansky-Pudlak syndrome (HPS) from non-syndromic OCA. MATERIALS AND METHODS: In a prospective consecutive case series, 63 patients (less than 18 years old) with a molecular genetic diagnosis of albinism (except OCA1A), Ocular albinism (OA) and Hermansky-Pudlak syndrome seen over a 3-year period were evaluated and analyzed. Hair colour, iris colour was graded, compared and correlated with the degree of fundus pigmentation and foveal development. RESULTS: A total of 63 patients were evaluated. Forty-five patients had non-syndromic OCA (11 OCA1B, 24 OCA2, 9 OCA4, and 1 OCA6), 5 patients had OA and 13 patients had HPS. All 3 BLOC-related HPS categories were seen (1 with BLOC1, 7 with BLOC-2 and 5 with BLOC-3 related HPS). All patients with OA were hyperopic, had darker fundus pigmentation, but had poor foveal development. All HPS patients had lighter fundus pigmentation. The degree of fundus pigmentation correlated positively with the iris pigmentation and also with the foveal development only in OCA2. CONCLUSIONS: Careful observation of the phenotype by comparison of the skin, hair, iris colour, with the degree of fundus pigmentation and foveal development may help clinically differentiate HPS from OCA patients of Chinese ethnicity even in the absence of any bleeding tendency.

GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

Foveal hypoplasia in parents of patients with albinism.

BACKGROUND: Albinism is a group of genetic disorders characterized by general skin and retinal hypopigmentation. It is in most cases an autosomal recessive condition. Foveal hypoplasia (FH) is one of the main criteria for the diagnosis of albinism. The aim of this study was to analyze the macular profile of the parents of patients with albinism. METHODS: This study included a case series of 27 patients with albinism seen in Rothschild Foundation between April 2017 and February 2020. Spectral-domain optical coherence tomography (SD-OCT) and OCT angiography (OCT-A) were performed in every patient when possible and in every available parents. FH was graded according to Thomas' classification based on OCT. Next generation sequencing-based gene panel testing was performed in parents and children when a FH was detected on OCT in a parent. RESULTS: Twenty-seven patients with albinism were examined. Nine parents had FH based on the OCT B-scan (33%). In parents without FH based on the SD-OCT B-scan (67%), OCT-A showed a reduced avascular zone in the deep vascular plexus in 4 parents. Six parents carried variants that could explain their phenotype, including TYR R402Q hypomorphic alleles. CONCLUSION: This study showed the presence of FH in parents of patients with albinism, and aimed to genetically explain this phenotype.

Macular Findings in Carriers of Ocular Albinism With a Novel GPR143 Mutation.

This case series details macular findings in three female siblings who were found to be carriers of a previously unreported splice mutation in GPR143 (X-linked ocular albinism [OA1]). Presumed lyonization is responsible for both the subtle and varied findings in OA1 carriers, even among siblings, and especially in patients with darker skin pigmentation. In this series, we used green-light autofluorescence to reveal subtle subfoveal involvement and used optical coherence tomography angiography to uncover previously unreported narrowing of the foveal avascular zone, consistent with foveal hypoplasia. [Ophthalmic Surg Lasers Imaging Retina 2022;53:460-463.].

CRISPR-AsCas12a Efficiently Corrects a GPR143 Intronic Mutation in Induced Pluripotent Stem Cells from an Ocular Albinism Patient.

Mutations in the GPR143 gene cause X-linked ocular albinism type 1 (OA1), a disease that severely impairs vision. We recently generated induced pluripotent stem cells (iPSCs) from skin fibroblasts of an OA1 patient carrying a point mutation in intron 7 of GPR143. This mutation activates a new splice site causing the incorporation of a pseudoexon. In this study, we present a high-performance CRISPR-Cas ribonucleoprotein strategy to permanently correct the GPR143 mutation in these patient-derived iPSCs. Interestingly, the two single-guide RNAs available for SpCas9 did not allow the cleavage of the target region. In contrast, the cleavage achieved with the CRISPR-AsCas12a system promoted homology-directed repair at a high rate. The CRISPR-AsCas12a-mediated correction did not alter iPSC pluripotency or genetic stability, nor did it result in off-target events. Moreover, we highlight that the disruption of the pathological splice site caused by CRISPR-AsCas12a-mediated insertions/deletions also rescued the normal splicing of GPR143 and its expression level.

Genotypic and Phenotypic Spectrum of Foveal Hypoplasia: A Multicenter Study.

PURPOSE: To characterize the genotypic and phenotypic spectrum of foveal hypoplasia (FH). DESIGN: Multicenter, observational study. PARTICIPANTS: A total of 907 patients with a confirmed molecular diagnosis of albinism, PAX6, SLC38A8, FRMD7, AHR, or achromatopsia from 12 centers in 9 countries (n = 523) or extracted from publicly available datasets from previously reported literature (n = 384). METHODS: Individuals with a confirmed molecular diagnosis and availability of foveal OCT scans were identified from 12 centers or from the literature between January 2011 and March 2021. A genetic diagnosis was confirmed by sequence analysis. Grading of FH was derived from OCT scans. MAIN OUTCOME MEASURES: Grade of FH, presence or absence of photoreceptor specialization (PRS+ vs. PRS-), molecular diagnosis, and visual acuity (VA). RESULTS: The most common genetic etiology for typical FH in our cohort was albinism (67.5%), followed by PAX6 (21.8%), SLC38A8 (6.8%), and FRMD7 (3.5%) variants. AHR variants were rare (0.4%). Atypical FH was seen in 67.4% of achromatopsia cases. Atypical FH in achromatopsia had significantly worse VA than typical FH (P < 0.0001). There was a significant difference in the spectrum of FH grades based on the molecular diagnosis (chi-square = 60.4, P < 0.0001). All SLC38A8 cases were PRS- (P = 0.003), whereas all FRMD7 cases were PRS+ (P < 0.0001). Analysis of albinism subtypes revealed a significant difference in the grade of FH (chi-square = 31.4, P < 0.0001) and VA (P = 0.0003) between oculocutaneous albinism (OCA) compared with ocular albinism (OA) and Hermansky-Pudlak syndrome (HPS). Ocular albinism and HPS demonstrated higher grades of FH and worse VA than OCA. There was a significant difference (P < 0.0001) in VA between FRMD7 variants compared with other diagnoses associated with FH. CONCLUSIONS: We characterized the phenotypic and genotypic spectrum of FH. Atypical FH is associated with a worse prognosis than all other forms of FH. In typical FH, our data suggest that arrested retinal development occurs earlier in SLC38A8, OA, HPS, and AHR variants and later in FRMD7 variants. The defined time period of foveal developmental arrest for OCA and PAX6 variants seems to demonstrate more variability. Our findings provide mechanistic insight into disorders associated with FH and have significant prognostic and diagnostic value.

Neurodevelopmental Profile in Children Affected by Ocular Albinism.

AIM: The aim of this study was to detail the neurodevelopmental profile of subjects affected by ocular albinism (OA) and to collect data on GPR143 gene analysis. DESIGN: The design of the study involves a retrospective longitudinal observational case series. METHODS: We collected data on the neurodevelopmental profile of 13 children affected by OA from clinical annual assessments conducted for a period of 6 years after the first evaluation. We described visual profile, neuromotor development and neurological examination, cognitive profile, communication and language skills and behavioral characteristics. The GPR143 gene analysis was performed as well. RESULTS: Children presented a variable combination of ocular and oculomotor disorders unchanged during the follow-up, a deficit in visual acuity and in contrast sensitivity that progressively improved. Abnormalities in pattern visual evoked potential were found. No deficits were detected at neurological examination and neuromotor development except for a mild impairment in hand-eye coordination observed in five cases. A language delay was observed in five cases, two of whom had also a developmental quotient delay at 2 years evolving to a borderline/deficit cognitive level at preschool age, difficulties in adaptive behavior and autistic-like features were found. Mutations in the GPR143 gene were identified in the two patients who presented the most severe clinical phenotype. CONCLUSION: Children with OA may share, in addition to a variable combination of ocular signs and symptoms, a neurodevelopment impairment regarding mostly the cognitive, communicative, and social area, especially those with GPR143 mutation.

GPR143 genotypic and ocular phenotypic characterisation in a Chinese cohort with ocular albinism.

PURPOSE: Ocular albinism type I (OA1) is caused by mutations in the GPR143 gene. The purpose of this study was to describe the clinical and genetic findings in 13 patients from 12 unrelated Chinese pedigrees with a pathogenic variant of the GPR143 gene. METHODS: Most patients underwent clinical examination, including best-corrected visual acuity (BCVA), slit-lamp biomicroscopy, fundus examination, spectral domain optical coherence tomography, and full-field electroretinograms (ERG). A combination of molecular screening procedures, consisting of Sanger-DNA sequencing of GPR143 and targeted next-generation sequencing, was performed to identify each mutation. In silico programs were utilized to evaluate the pathogenicity of all the variants. RESULTS: The 13 patients (mean age 21.75 ± 16.63 years, range 1-54 years) all presented with congenital nystagmus, different extents of visual impairment, and severe foveal hypoplasia. Their BCVA was between 0.05 and 0.3 (decimal notation). The patients and obligate carriers exhibited different extents of mild depigmentation of the iris and fundus. We detected 11 distinct mutations in this patient cohort, including 7 novel mutations. Most (82%) were null mutations and included frameshift indel, nonsense, splicing effect, and large genomic DNA deletions, while missense mutations only accounted for 18%. CONCLUSIONS: Patients with GPR143 mutations all have congenital nystagmus, visual impairment, and foveal hypoplasia, whereas hypopigmentation in their iris and fundus is mild. They exhibit no evident genotype-phenotype correlations. GPR143 mutation screening is very important for establishing a precise diagnosis and for providing genetic counseling for patients and their families.

Prospective Study of the Phenotypic and Mutational Spectrum of Ocular Albinism and Oculocutaneous Albinism.

Albinism encompasses a group of hereditary disorders characterized by reduced or absent ocular pigment and variable skin and/or hair involvement, with syndromic forms such as Hermansky-Pudlak syndrome and Chédiak-Higashi syndrome. Autosomal recessive oculocutaneous albinism (OCA) is phenotypically and genetically heterogenous (associated with seven genes). X-linked ocular albinism (OA) is associated with only one gene, GPR143. We report the clinical and genetic outcomes of 44 patients, from 40 unrelated families of diverse ethnicities, with query albinism presenting to the ocular genetics service at Moorfields Eye Hospital NHS Foundation Trust between November 2017 and October 2019. Thirty-six were children (≤ 16 years) with a median age of 31 months (range 2-186), and eight adults with a median age of 33 years (range 17-39); 52.3% (n = 23) were male. Genetic testing using whole genome sequencing (WGS, n = 9) or a targeted gene panel (n = 31) gave an overall diagnostic rate of 42.5% (44.4% (4/9) with WGS and 41.9% (13/31) with panel testing). Seventeen families had confirmed mutations in TYR (n = 9), OCA2, (n = 4), HPS1 (n = 1), HPS3 (n = 1), HPS6 (n = 1), and GPR143 (n = 1). Molecular diagnosis of albinism remains challenging due to factors such as missing heritability. Differential diagnoses must include SLC38A8-associated foveal hypoplasia and syndromic forms of albinism.

Genotype-phenotype associations in Danish patients with ocular and oculocutaneous albinism.

BACKGROUND: The study aimed to describe genotype-phenotype associations in patients with oculocutaneous and ocular-only albinism and to evaluate a set of diagnostic criteria proposed recently by Kruijt et al. MATERIALS AND METHODS: Genotype-phenotype associations in patients with a clinical diagnosis of albinism were studied based on imaging of hair and ocular features (nystagmus, iris color and translucency, fundus pigmentation and foveal development) and self-evaluated skin type. Patients were sub-grouped based on genetic findings. RESULTS: Patients with biallelic variants in TYR (n = 29), OCA2 (n = 22), other albinism genes (n = 13) or monoallelic variants in GPR143 (n = 13) were included as were 15 patients with a pure clinical diagnosis but no genetic findings. In descending order the most common findings were: foveal hypoplasia (any hypoplasia 95.2%, severe 88.0%), nystagmus (93.5%), iris translucency (any translucency 80.2%, moderate to severe 31.5%), misrouting on VEP (80.0%): fundus hypopigmentation (any hypopigmentation: 75.8%, severe 30.1%), fair skin type (73.8%), blue irides (62.0%), blonde hair (57.5%), and unpigmented eye lashes (39.1%). There were no phenotypic differences between the different genetic subgroups of albinism but patients with a pathogenic haplotype in TYR in combination with a classic variant had less iris translucency than patients with two classic variants in TYR. CONCLUSIONS: Ocular developmental features were the most common findings whereas phenotypic features related to pigmentation were less common findings but there were no genotype-phenotype correlations. All patients with a genetically confirmed diagnosis of albinism fulfilled the diagnostic criteria by Kruijt irrespective of genetic subtype.

A Novel Splice-Site Variant in CACNA1F Causes a Phenotype Synonymous with Åland Island Eye Disease and Incomplete Congenital Stationary Night Blindness.

BACKGROUND: CACNA1F-related disorders encompass progressive and non-progressive disorders, including Åland island eye disease and incomplete congenital stationary night blindness. These two X-linked disorders are characterized by nystagmus, color vision defect, myopia, and electroretinography (ERG) abnormalities. Ocular hypopigmentation and iris transillumination are reported only in patients with Åland island eye disease. Around 260 variants were reported to be associated with these two non-progressive disorders, with 19 specific to Åland island eye disease and 14 associated with both Åland island eye disease and incomplete congenital stationary night blindness. CACNA1F variants spread on the gene and further analysis are needed to reveal phenotype-genotype correlation. CASE REPORT: A complete ocular exam and genetic testing were performed on a 13-year-old boy. A novel splice-site variant, c.4294-11C>G in intron 36 in CACNA1F, was identified at hemizygous state in the patient and at heterozygous state in his asymptomatic mother and explained the phenotype synonymous with Åland island eye disease and incomplete congenital stationary night blindness observed in the patient. CONCLUSION: We present a novel variant in the CACNA1F gene causing phenotypic and electrophysiologic findings indistinguishable from those of AIED/CSNB2A disease. This finding further expands the mutational spectrum and our knowledge of CACNA1F-related disease.