First Report of Wheat streak mosaic virus in Slovakia.

The occurrence of Wheat streak mosaic virus (WSMV; genus Tritimovirus) was monitored by testing 91 wheat and barley samples collected from various localities of Slovakia from March to June 2007. Samples were screened by a commercial double-antibody sandwich-ELISA kit (Loewe Biochemica, Sauerlach, Germany). Positive results were obtained from two wheat (Triticum aestivum L.) samples from the same locality of western Slovakia. Molecular analysis of both samples was performed by reverse transcription-PCR with WSMV-specific primers (WS-8166F 5' GAGAGCAATACTGCGTGTACG 3' and WS-8909R 5' GCATAATGGCTCGAAGTGATG 3') designed according to available sequences. The expected 750-bp PCR fragment containing the N-terminal and core region of the coat protein gene (from 8166 to 8909 nt based on the Sidney81 isolate, GenBank Accession No AF057533) was obtained from both Slovak isolates. Direct sequencing (GenBank Accession Nos. EU723085 and EU723086) revealed that the two isolates have nucleotide and amino acid sequence identities of 98.3 and 100%, respectively. Except for the highly divergent Mexican isolate (Accession No. AF285170), pairwise comparisons of the Slovak isolates with sequences of other WSMV isolates (1) available in GenBank indicated respective nucleotide and amino acid sequence identities ranging from 87.6 to 98.7% and 95.2 to 100%. The Slovak isolates were most closely related to isolates from Czech Republic, Hungary, and Russia (GenBank Accession Nos. AF454454, AF454456, and AF454459). To our knowledge, this is the first report of the natural occurrence of WSMV in Slovakia. Reference: (1) D. C. Stenger et al. Virology 302:58. 2002.

Molecular analysis of the 3' terminal region of the genome of Beet mosaic virus and its relation with other potyviruses.

A1633 nucleotides long 3'-terminal sequence of genome of the Beet mosaic virus (BtMV) Ren1 isolate from Slovakia, spanning a part of the NIb gene, complete capsid protein (CP) gene and a 3'non-coding region was determined. Computer-assisted translation resulted in a polypeptide encompassing typical conserved potyviral amino acid (aa) motifs. Homology BLAST search and phylogenetic analysis revealed that BtMV was closest to Bean common mosaic virus, Soybean mosaic virus and Zucchini yellow mosaic virus. An unexpectedly high, 99.6% aa sequence identity was found between BtMV-Ren1 and a previously sequenced British BtMV isolate. Restriction analysis and sequencing of the CP gene of other Slovak BtMV isolates revealed their high homology. Developed reverse transcription-polymerase chain reaction protocols enabled sensitive, rapid and reliable detection of the virus.

Evidence of a Naturally Occurring Recombinant Isolate of Plum pox virus from Slovakia.

Sharka, caused by the Plum pox virus (PPV), is the most detrimental viral disease of stone fruit trees worldwide. Two main groups of PPV isolates have been identified, PPV-M and PPV-D (1). Natural variability of Slovak PPV isolates in Prunus hosts has been recently evaluated (3). The PPV isolate BOR-3 was isolated in the summer of 1996 from a 5-year-old apricot tree, cv. VS 123/9, in an orchard in western Slovakia. The host apricot tree was propagated from seed; hence infection via aphid transmission from the immediate surroundings is highly probable. In order to retain its original properties, the isolate was transmitted by chip budding from a diseased tree to seedlings of Prunus persica, cv. GF 305. In contrast to other PPV isolates collected from the same location, infection of GF 305 with BOR-3 was either symptomless or produced only weak symptoms. On the other hand, sap-infected young seedlings of P. insititia × P. domestica St. Julien No. 2 presented leaf chlorotic spots and rings similar to those produced by other tested Slovak PPV isolates. Serological typing with group-specific MAbs (1) and restriction fragment length polymorphism of RT-PCR products amplified from the C terminus of the capsid protein (CP) gene demonstrated that BOR-3 is a member of PPV-M group (3). However, nucleotide (nt) sequence analysis of the P3-6K1 genomic region (GenBank accession AF357541) has shown a strong similarity with PPV-D group isolates (reaching 97%). To obtain more information, a 1846-nt long 3 genomic region encompassing the C-terminus of NIb, CP and 3 noncoding region (NCR) was subsequently sequenced (GenBank accession AY028309). The sequence comparison revealed that the BOR-3 isolate was the most identical to the PPV isolate ð6 (GenBank accession S57404) isolated more than 10 years ago in former Yugoslavia, which is about 550 km from the Slovak focus. The ð6 isolate is known to be the only PPV RNA recombinant at present (2). Nucleotide sequence identity in 3'NIb+CP+NCR region between BOR-3 and ð6 isolates reached >98%, contrary to 96% identity with PPV-M isolates (PS, SK68) and 88% identity with PPV-D isolates (Dideron, Rank). Further, the potential recombination site in the BOR-3 genome has been located in the C-terminus of NIb gene near nt position 8450 (numbered according to PPV-PS isolate, AJ243957). This site corresponds to the location of the recombination crossover identified in the PPV-ð6 isolate (2). Despite geographical and temporal distinctiveness of the two PPV isolates, an identical origin of ð6 and BOR-3 cannot be excluded. The hypothesis that these PPV isolates are the product of two independent recombination events at a recombination hot spot in the PPV genome situated near the C terminus of NIb gene also should be considered. Based on these data, the PPV BOR-3 isolate is a product of a natural homologous RNA recombination event between an M and D isolate. Evidence of homologous RNA recombination in this isolate significantly enriches current knowledge on the occurrence of recombination among potyviruses and emphasizes the role of RNA recombination in viral evolution and adaptation. This report indicates that occurrence of recombinants within PPV isolates infecting perennial crops might not be as rare as previously suggested (4). References: (1) T. Candresse et al. Phytopathology 88:198, 1998. (2) M. T. Cervera et al. J. Gen. Virol. 74:329, 1993. (3) M. Glasa et al. Acta Virol. 42:226, 1998. (4) F. Revers et al. J. Gen. Virol. 77:1953, 1996.

Strain variability of plum pox virus isolates from western Slovakia.

Leaf tissues of stone fruit trees (plum, apricot, peach and myrobalan) carrying symptoms of plum pox virus (PPV) infection and of peach GF 305 seedlings and Nicotiana benthamiana infected experimentally with PPV were assayed for PPV by polymerase chain reaction (PCR). The expected 243 bp PCR products were subjected to restriction fragment length polymorphism (RFLP) analysis with restriction endonucleases AluI and RsaI. All of the PCR products contained the AluI site. The RsaI restriction profiles of the PCR products demonstrated the prevalence of PPV-M subgroup in the tested samples from western Slovakia.

Characterization of plum pox virus isolates from Slovakia.

Plum pox virus (PPV) isolates from stone-fruit trees (plums, myrobalans, apricots and peaches) from orchards and gardens were characterized. To characterize their biological properties, several PPV isolates were transmitted by chip budding to GF 305 seedlings and mechanically to selected herbaceous test plants. The isolates differed in severity of infection, host range and symptomatology. A subgroup differentiation of 43 isolates from 22 localities of western and middle Slovakia was accomplished using reverse transcription-polymerase chain reaction (RT-PCR), immunocapture RT-PCR (IC-RT-PCR) and restriction analysis. These assays confirmed the presence of isolates belonging to PPV-M and PPV-D subgroups. PPV-M and PPV-D isolates were almost equally represented in tested samples. Tests of subgroup variability of PPV isolates from infected tolerant plum cultivars showed great predominance of PPV-M isolates.

Susceptibility of peach GF 305 seedlings and selected herbaceous plants to plum pox virus isolates from western Slovakia.

The susceptibility of peach GF 305 seedlings and herbaceous plants to five plum pox virus (PPV) isolates from orchards of western Slovakia was investigated. PPV was isolated from diseased plum, apricot and peach trees, and transmitted by chip-budding to peach GF 305. The herbaceous plants were infected by mechanical inoculation. The transmission was analysed by symptomatology and double sandwich enzyme-linked immunosorbent assay (DAS-ELISA). Infected peaches developed leaf distortion, tissue clearing along the veins and small chlorotic spots (isolate BOR-3). With exception of BOR-3, the PPV isolates transmitted from peach caused local chlorotic spots on Chenopodium foetidum. The character of symptoms changed when a sap from PPV-infected Nicotiana benthamiana was used as virus inoculum. From N. benthamiana, the PPV isolates could be transmitted to Pisum sativum, cv. Colmo (light green mosaic), N. clevelandii and N. clevelandii x N. glutinosa hybrid (latent infection or chlorotic spots).

Conformational changes in pH2-treated human interferon-alpha 2 detected with monoclonal antibodies.

Monoclonal antibodies allowed to demonstrate the existence of alternative antigenic forms of the same molecule as of human interferon (IFN)-alpha 2. Exposure of recombinant IFN to pH 2, although not affecting its bioactivity, induced structural modulation of molecular surface. The antigenic structure of IFN-alpha 2 appeared to be built of the acid-stable and acid-labile epitopes. In general, the acid-stable sites determined subtype-specific antigenic properties of the protein, whereas the acid-labile determinants were responsible for antigenic characteristics shared by some other human IFNs. Acidification of IFN-alpha 2 to pH 2 for at least 1-2 h resulted in simultaneous structural rearrangement of all acid-labile sites.

Alfalfa mosaic virus strains T6 and 425 differ in their capsid protein.

Capsid proteins (CPs) of two strains of alfalfa mosaic virus (AIMV)-T6 and 425-were compared using sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) peptide mapping and two-dimensional PAGE (2D-PAGE). The CPs had identical molecular mass but differed in their peptide pattern and charge. The AIMV strain T6 was isolated from lucerne in Czech Republic (Gallo, 1977). Previously, its morhology, symptomatology and RNA electrophoretic mobility were characterized and compared with those of the strain 425 (Hagedorn and Handson, 1963; Kúdela and Gallo, 1995). In this study we show that the CP composition of these two AIMV strains differs, too. AIMV, the unique member of the genus Alfamovirus, family Bromoviridae, is of economic significance in many countries in the world, particularly for its seed transmissibility and relative broad host range. Plenty of strains with different biological properties have been isolated (Van Regenmortel and Pinck, 1981). Some of them have been shown to differ in their RNA non-coding regions or in CP composition (Kraal, 1975; Kraal et al., 1976; Collot et al., Dore et al., 1989; Neeleman et al., 1991).

Characterization of the alfalfa mosaic virus strain T6.

A strain T6 of alfalfa mosaic virus (AlMV) was characterized. It was isolated from field grown lucerne. Purified virus preparations contained four types of particles, B, M, Tb and Ta, containing separately encapsidated ssRNAs 1 to 4. The strain T6 was able to infect 40 different plant species of 9 families, and to develop a systemic infection in most of them. The symptomatology on bean and the RNA mobility of the AlMV strains T6 and 425 were compared. The classical cross-protection experiments on bean have shown that plants inoculated with strain 425 did not develop symptoms of the challenge strain T6.

Detection of herpes simplex virus DNA by polymerase chain reaction in the cerebrospinal fluid of patients with viral meningoencephalitis using primers for the glycoprotein D gene.

A novel set of primers for polymerase chain reaction (PCR) which amplified the portion of US6 sequence coding for the main type-common neutralizing epitope of glycoprotein D (gD) was used for detection of herpes simplex virus (HSV) DNA in 44 cerebrospinal fluid (CSF) samples from 29 patients with clinical symptoms of viral meningitis or meningoencephalitis. The primers in question amplified the DNA of 9 out of 10 low-passage HSV-1 isolates and of 5 out of 10 HSV-2 low-passage isolates as well as the DNA of all laboratory strains examined when tested in the supernatant fluid of infected cells cultures. The PCR was positive in 5 CSF samples (taken on days 2, 4, 8, 10 and 56 after the onset of symptoms, but not later than day 8 after starting acyclovir (ACV) therapy) obtained from 4 patients with intrathecal antibody response. The PCR was repeatedly negative in CSF of 15 patients who had antibodies to HSV in serum and CSF, but did not show intrathecal antibody production. It was also negative in 10 patients who had no HSV antibodies in CSF. Our results confirmed that positive PCR for HSV DNA in the CSF is an indication for starting and/or continuing ACV therapy even in the absence of classical symptoms of HSV encephalitis.

The use of consensus sequence for amplification and oriented cloning of human alpha interferon genes.

A clone from human cDNA library was amplified in polymerase chain reaction (PCR) by the synthetic oligonucleotides. The final construct after linker ligation and digestion with restriction endonucleases was suitable for oriented cloning into E. coli expression vector. The interferon (IFN) expression could be detected by SDS-PAGE electrophoresis. Western blotting and biological antiviral assay. This set of oligonucleotides can be used also for amplification of genomic DNA or cDNA libraries.