Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 4.106
Filtrar
1.
Aging (Albany NY) ; 13(undefined)2021 Sep 10.
Artigo em Inglês | MEDLINE | ID: mdl-34506303

RESUMO

INTRODUCTION: This multicenter, retrospective study assessed the prevalence of post-stroke cognitive impairment (PSCI) 6 months after acute ischemic stroke (AIS) and its risk factors to build a bedside early predictive model for PSCI using the Montreal Cognitive Assessment (MoCA). METHODS: Records of consecutive patients with AIS treated at 4 stroke centers in Shanghai had MoCA assessments within 2 weeks after AIS onset and 6 months later were reviewed. Prevalence of PSCI (MoCA<22) was calculated and risk factors were identified by multivariate logistic regression analysis. The modeling and validation and identified risk factors were included in a predictive model using multivariate regression. RESULTS: There were 383 patients included and prevalence of PSCI 6 months after AIS was 34.2%, significantly lower than prevalence of patients with acute cognitive impairment (49.6%). Aging, less education, higher glucose level and severe stroke were PSCI risk factors, while level of low-density lipoprotein cholesterol (LDL-C) had a paradox effect on the risk of PSCI. 40.0% of the patients with cognitive impairment at acute phase reverted to normal, and patients with LDL-C 1.8-2.5 mmol/L were more likely to revert. The predictive model we built, DREAM-LDL (Diabetes [fasting blood glucose level], Rating [NIHSS], level of Education, Age, baseline MoCA and LDL-C level), had an AUROC of 0.93 for predicting PSCI at 6 months. CONCLUSION: PSCI was common among AIS patients 6 months after AIS. We provided a practical tool to predict PSCI based on MoCA and risk factors present during acute phase of AIS.

2.
Int J Mol Sci ; 22(17)2021 Aug 24.
Artigo em Inglês | MEDLINE | ID: mdl-34502018

RESUMO

Gibberellin 2-oxidase (GA2ox) plays an important role in the GA catabolic pathway and the molecular function of the OsGA2ox genes in plant abiotic stress tolerance remains largely unknown. In this study, we functionally characterized the rice gibberellin 2-oxidase 8 (OsGA2ox8) gene. The OsGA2ox8 protein was localized in the nucleus, cell membrane, and cytoplasm, and was induced in response to various abiotic stresses and phytohormones. The overexpression of OsGA2ox8 significantly enhanced the osmotic stress tolerance of transgenic rice plants by increasing the number of osmotic regulators and antioxidants. OsGA2ox8 was differentially expressed in the shoots and roots to cope with osmotic stress. The plants overexpressing OsGA2ox8 showed reduced lengths of shoots and roots at the seedling stage, but no difference in plant height at the heading stage was observed, which may be due to the interaction of OsGA2ox8 and OsGA20ox1, implying a complex feedback regulation between GA biosynthesis and metabolism in rice. Importantly, OsGA2ox8 was able to indirectly regulate several genes associated with the anthocyanin and flavonoid biosynthetic pathway and the jasmonic acid (JA) and abscisic acid (ABA) biosynthetic pathway, and overexpression of OsGA2ox8 activated JA signal transduction by inhibiting the expression of jasmonate ZIM domain-containing proteins. These results provide a basis for a future understanding of the networks and respective phenotypic effects associated with OsGA2ox8.

3.
J Am Chem Soc ; 2021 Sep 13.
Artigo em Inglês | MEDLINE | ID: mdl-34514797

RESUMO

Taking advantage of cancer cells' endogenous characters, the responsive activation of DNA nanomachines has achieved great success in tumor therapy. Combining with extra stimuli such as external light irradiation provided spatiotemporal control of DNA nanomachine activation. However, specific activation at the cellular level is still challenging considering the macroscopic-scale exposure area of usual light sources. DNA logic gates located at the cell membrane contributed to cellular specificity, but the free diffusion of input DNA strands during the operation process would impair efficiency and result in side effects to circumjacent normal cells in solid tumors. Here we design a transmembrane DNA logical computation strategy to activate a DNA nanomachine only in cancer cells from a complex solid tumor microenvironment. The DNA nanomachine multishell UCNPs-DNA is prepared by modifying DNA strands on upconversion nanoparticles. LA-apt, a DNA strand anchoring to a cancer cell membrane overexpressed receptor, and intracellular miRNA-21 served as inputs 1 and 2, respectively. Hybridization with input 1 at the cell membrane not only exposes the miRNA-21 recognition region at the DNA nanomachine, but also delivers it into cancer cells. The cascade hybridization with intracellular input 2 completes the "AND" gate operation and releases a DNA strand L2 as output. L2 acts as the trigger to operate the DNA nanomachine and correspondingly activates the photosensitizer Rose Bengal for reactive oxygen species generation. Through the "AND" gate operation of the DNA nanomachine across the cancer cell membrane, highly precise therapy only to cancer cells is achieved in a complex solid tumor microenvironment, which could become a promising modality for precise therapy of solid tumors.

4.
Plant Dis ; 2021 Sep 13.
Artigo em Inglês | MEDLINE | ID: mdl-34515511

RESUMO

Late blight caused by Phytophthora infestans (Mont.) De Bary is the most destructive diseases in the potato field. Although it has been studied worldwide, it has not been reported in Tibet Autonomous Region of China, lying on the world's highest plateau. To investigate whether the disease caused by P. infestans occurred in such region, a survey on potato disease was conducted in the summer in 2020. In August, potato (Solanum tuberosum) of the cultivar 'Longshu 10' with diseased leaves was observed in a potato field in Shigatse city in Tibet Autonomous Region (29.3N,88.8E). The necrotic brown lesions were shaped in round or irregularly with whitish growth of sporangium-producing structures on the underleaf surface, similar to typical late blight symptom. Affected leaves were collected for pathogen isolation. The abaxial side of the decayed leaves showed grey zones of sporulation. Upon isolation, three isolates were used for further investigation. The mycelium grew averagely at a linear rate of 4.35 mm per day at 19oC on Rye B agar (RBA, containing 50 g/L rye and 12 g/L agar), forming white colony. The opaque and lemon-shaped spores with a papilla at the distal end (Figure S1) had an average size of 36.2ⅹ20.3 µm, the shape and size consistent with P. infestans (Cardenas et al. 2011; Winton et al. 2007). The ribosomal ITS1-5.8S-ITS2 region was amplified from genomic DNA obtained from mycelium using primers ITS1 and ITS4 (Glass and Donaldson 1995). The sequences with 829 bp in size obtained from three isolates were identical, among which one of the sequences from Tibet isolate RKZ_27 was submitted to GenBank with Accession No. of MW559423. A BLAST search in NCBI (National Center for Biothchnology Information) revealed MW559423 had the highest similarity (100%) to P. infestans sequences (GenBank Accession No. of MK507866, MH401206 and KU992300). In addition, a partial nucleus DNA sequence from elongation factor 1-α (EF1-α) was amplified using primer set of EF_F/ EF_R (EF_F: 5'GGCCTTGACGACATCCAGAA3'; EF_R: 5'TAGCAGCTCAACCCGAAGTG3'), and a partial mitochondria DNA sequence (P2 region) including partial ATP synthase F1 subunit α gene (atp1), tRNA-Glu gene and partial NADH dehydrogenase subunit 4 (ND4) was amplified using primer set of P2F/P2R (P2F: 5'TTCCCTTTGTCCTCTACCGAT3'; P2R: 5'TTACGGCGGTTTAGCACATACA3') (Vargas et al. 2009). The EF1-α and P2 region for three isolates were all identical and one of each sequence was submitted to GenBank with Accession No. of MZ189257 and MZ399710, respectively, which had 99.78% (XM_002998924.1) and 100% (MG869098) similarity with P. infestans, respectively. Phylogenetic analyses showed that the RKZ_27 was close to P. infestans (Figure S2). Pathogenicity was confirmed by inoculating ten potato leaves cv. 'Favorita' for each isolate with a 5 mm in diameter mycelium plug on each leaf. After 3 days of incubation at 19 oC in air-tight plastic bags, the inoculated leaves developed typical symptoms of late blight. All control leaves treated with distilled water remained healthy. The pathogenicity of three isolates were also confirmed by inoculating potato seedlings cv. 'Favorita' with sporangia suspension. The pathogen re-isolation on inoculated symptomatic leaves and seedlings were confirmed to be P. infestans by the morphological characteristics, which was fulfilled Koch postulates. The pathogenicity test both on leaves and seedlings were conducted twice. To our knowledge, this is the first report of P. infestans in potato field in Tibet Autonomous Region of China. The finding of potato late blight in this region have important epidemiological implications for the growers especially under favorable environmental conditions.

5.
Comput Biol Med ; 137: 104840, 2021 Sep 06.
Artigo em Inglês | MEDLINE | ID: mdl-34508972

RESUMO

INTRODUCTION: Finite element (FE) mechanics models of the heart are becoming more sophisticated. However, there is lack of consensus about optimal element type and coupling of FE models to the circulation. We describe biventricular (left (LV) and right (RV) ventricles) FE mechanics model creation using hexahedral elements, airbags and a functional mockup interface (FMI) to lumped-parameter models of the circulation. METHODS: Cardiac MRI (CMR) was performed in two healthy volunteers and a single patient with ischemic heart disease (IHD). CMR images were segmented and surfaced, meshing with hexahedral elements was performed with a "thin butterfly with septum" topology. LV and RV inflow and outflow airbags were coupled to lumped-parameter circulation models with an FMI interface. Pulmonary constriction (PAC) and vena cava occlusion (VCO) were simulated and end-systolic pressure-volume relations (ESPVR) were calculated. RESULTS: Mesh construction was prompt with representative contouring and mesh adjustment requiring 32 and 26 min Respectively. The numbers of elements ranged from 4104 to 5184 with a representative Jacobian of 1.0026 ± 0.4531. Agreement between CMR-based surfaces and mesh was excellent with root-mean-squared error of 0.589 ± 0.321 mm. The LV ESPVR slope was 3.37 ± 0.09 in volunteers but 2.74 in the IHD patient. The effect of PAC and VCO on LV ESPVR was consistent with ventricular interaction (p = 0.0286). CONCLUSION: Successful co-simulation using a biventricular FE mechanics model with hexahedral elements, airbags and an FMI interface to lumped-parameter model of the circulation was demonstrated. Future studies will include comparison of element type and study of cardiovascular pathologies and device therapies.

6.
BMC Anesthesiol ; 21(1): 223, 2021 Sep 13.
Artigo em Inglês | MEDLINE | ID: mdl-34517840

RESUMO

BACKGROUND: Dexmedetomidine promotes normal sleep architecture; the drug also improves analgesia. We therefore tested the hypothesis that supplementing intravenous analgesia with dexmedetomidine reduces delirium in older patients recovering from orthopedic surgery. METHODS: In this double-blinded randomized controlled trial, we enrolled 712 older (aged 65-90 years) patients scheduled for major orthopedic surgery. Postoperative analgesia was provided by patient-controlled intravenous sufentanil, supplemented by randomly assigned dexmedetomidine (1.25 µg/mL) or placebo, for up to three days. The primary outcome was the incidence of delirium assessed twice daily with the Confusion Assessment Method. Among secondary outcomes, pain severity was assessed twice daily and sleep quality once daily, each with an 11-point scale where 0 = no pain/the best possible sleep and 10 = the worst pain/the worst possible sleep. RESULTS: The incidence of postoperative delirium was 7.3% (26 of 354) with placebo and 4.8% (17 of 356) with dexmedetomidine; relative risk 0.65, 95% CI 0.36 to 1.18; P = 0.151. Dexmedetomidine reduced pain both at rest (median difference -1 to 0 points, P ≤ 0.001) and with movement (-1 points, P < 0.001) throughout the first 5 postoperative days; it also improved subjective sleep quality during the first 3 postoperative days: day one median difference -1 point (95% CI -1 to 0), P = 0.007; day two 0 point (-1 to 0), P = 0.010; and day three 0 point (-1 to 0), P = 0.003. The incidence of adverse events was similar in each group. CONCLUSIONS: Supplementing sufentanil intravenous analgesia with low-dose dexmedetomidine did not significantly reduce delirium, but improved analgesia and sleep quality without provoking adverse events. TRIAL REGISTRATION: www.chictr.org.cn : ChiCTR1800017182 (Date of registration: July 17, 2018); ClinicalTrials.gov: NCT03629262 (Date of registration: August 14, 2018).

7.
PLoS One ; 16(9): e0257425, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-34520494

RESUMO

BACKGROUND: This novel meta-analysis was conducted to systematically and comprehensively evaluate the prognostic role of the pretreatment PNI in patients with head and neck neoplasms (HNNs) undergoing radiotherapy. METHODS: Three databases, PubMed, Embase, and Web of Science, were used to retrieve desired literature. Hazard ratios (HRs) with 95% confidence intervals (CIs) were extracted and pooled by fixed-effects or random-effects models to analyze the relationship between the PNI and survival outcomes: overall survival (OS), distant metastasis-free survival (DMFS), and progression-free survival (PFS). RESULTS: Ten eligible studies involving 3,458 HNN patients were included in our analysis. The robustness of the pooled results was ensured by heterogeneity tests (I2 = 22.6%, 0.0%, and 0.0% for OS, DMFS, and PFS, respectively). The fixed-effects model revealed a lower pretreatment PNI was significantly related to a worse OS (HR = 1.974; 95% CI: 1.642-2.373; P<0.001), DMFS (HR = 1.959; 95% CI: 1.599-2.401; P<0.001), and PFS (HR = 1.498; 95% CI: 1.219-1.842; P<0.001). The trim-and-fill method (HR = 1.877; 95% CI: 1.361-2.589) was also used to prove that the existing publication bias did not deteriorate the reliability of the relationship. CONCLUSION: The pretreatment PNI is a promising indicator to evaluate and predict the long-term prognostic survival outcomes in HNN patients undergoing radiotherapy.

8.
Environ Pollut ; 291: 118076, 2021 Sep 02.
Artigo em Inglês | MEDLINE | ID: mdl-34534824

RESUMO

Because the pollutants produced by human activities have destroyed the ecological balance of natural water environment, and caused severe impact on human life safety and environmental security. Hence the task of water environment restoration is imminent. Metal-organic frameworks (MOFs), structured from organic ligands and inorganic metal ions, are notable for their outstanding crystallinity, diverse structures, large surface areas, adsorption performance, and excellent component tunability. The water stability of MOFs is a key requisite for their possible actual applications in separation, catalysis, adsorption, and other water environment remediation areas because it is necessary to safeguard the integrity of the material structure during utilization. In this article, we comprehensively review state-of-the-art research progress on the promising potential of MOFs as excellent nanomaterials to remove contaminants from the water environment. Firstly, the fundamental characteristics and preparation methods of several typical water-stable MOFs include UiO, MIL, and ZIF are introduced. Then, the removal property and mechanism of heavy metal ions, radionuclide contaminants, drugs, and organic dyes by different MOFs were compared. Finally, the application prospect of MOFs in pollutant remediation prospected. In this review, the synthesis methods and application in water pollutant removal are explored, which provide ways toward the effective use of water-stable MOFs in materials design and environmental remediation.

9.
Ann Med ; 53(1): 1632-1641, 2021 12.
Artigo em Inglês | MEDLINE | ID: mdl-34498500

RESUMO

BACKGROUND: Disturbances in maternal lipid metabolism may increase the risk of developing pregnancy complications and adverse perinatal outcomes. However, there is no consensus as to what constitutes normal serum lipid ranges during pregnancy. Our study was aimed to establish trimester-specific serum lipid reference intervals (RIs) and investigate the associations between maternal dyslipidaemia and adverse outcomes in a population-based study. METHODS: The first- and third-trimester lipid profiles were derived from 16,489 singlet pregnant women for regular antenatal check-ups between 2017 and 2019. The serum samples were assayed for total cholesterol (TC), triglycerides (TG), high-density lipoprotein-cholesterol (HDL-C), and low-density lipoprotein-cholesterol (LDL-C) in the institutional clinical laboratory. The trimester-specific lipid RIs were estimated with both of the direct observational and the indirect Hoffmann methods. The associations between maternal lipid profiling and pregnancy complications and perinatal outcomes were assessed statistically. RESULTS: Serum levels of TC, TG, LDL-C and HDL-C were all increased significantly in the third trimester of pregnancy. There was no significant difference between the observed RIs established with healthy pregnant women and the calculated RIs derived from the Hoffmann method. A trend towards increased risks of gestational complications and adverse perinatal outcomes was observed in the subjects with elevated levels of TC, TG, and LDL-C or decreased level of HDL-C. CONCLUSIONS: In pregnancy, increased serum levels of TC, TG and LDL-C, and a decreased level of HDL-C posed higher risks of developing pregnancy complications and adverse perinatal outcomes.Key messagesIt is necessary to establish trimester-specific reference intervals for serum lipids including TC, TG, LDL-C and HDL-C that were found significantly increased as the gestational age went up. More importantly, around the upper reference limits of TC, TG and LDL-C (or the lower reference limit of HDL-C), the higher the serum lipid levels were (or the lower the HDL-C level was), the higher risks of developing pregnancy complications and adverse perinatal outcomes were observed.

10.
Int J Chron Obstruct Pulmon Dis ; 16: 2561-2573, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-34522094

RESUMO

Background: This study aimed to reveal the correlation between serum soluble interleukin-2 receptor (sIL-2R) and prognosis in patients with acute exacerbation of chronic obstructive pulmonary disease (AECOPD). Methods: A total of 315 patients diagnosed with AECOPD between December 2017 and June 2020 were enrolled. The patients were divided into the good and adverse groups based on the outcomes. An adverse outcome in COPD exacerbation was defined by the presence of at least one of the following: (1) death from a respiratory cause during hospitalisation or within 1 month of follow-up; (2) intensive care unit admission; (3) invasive or non-invasive mechanical ventilation; and (4) COPD-related emergency visit or readmission within 1 month of follow-up. A good outcome was considered as the absence of all the aforementioned issues. The patients underwent lung function (spirometry) assessment, and clinical and inflammatory profiles were collected. Univariate and multivariate analyses were performed to identify the correlation between serum sIL-2R concentration and other variables related to adverse outcomes of AECOPD. The receiver operating characteristic curve was used to show the predictive ability of sIL-2R for adverse outcomes of AECOPD. Results: We enrolled 315 patients, of whom 161 and 154 had good and adverse outcomes, respectively. We demonstrated that patients with adverse outcomes of AECOPD had a higher concentration of serum sIL-2R than patients with good outcomes (p < 0.001). The increased serum sIL-2R was positively associated with mMRC scores (p < 0.001), GLOD grades (p < 0.001), frequent exacerbation (p < 0.001), and smoking (p < 0.001) in patients with AECOPD and negatively correlated with pulmonary function (p < 0.001). An elevated sIL-2R level was a predictor for the risk of adverse outcomes in AECOPD with a cut-off value of 860 U/mL. Conclusion: Increased serum sIL-2R concentration correlated with the risk of the adverse outcomes in AECOPD, indicating that it can be a predictive factor contributing to the diagnosis and assessment of adverse outcomes in patients with AECOPD.

11.
J Phys Chem B ; 2021 Sep 15.
Artigo em Inglês | MEDLINE | ID: mdl-34524821

RESUMO

Understanding how the conformational change of conjugated molecules with acceptor-donor-acceptor (A-D-A) architecture affects their physical and optoelectronic properties is critical for determining their ultimate performance in organic electronic devices. Here, we utilized femtosecond transient absorption, time-resolved upconversion photoluminescence spectroscopy, and tunable femtosecond-stimulated Raman spectroscopy, aided by quantum chemical calculations, to systematically investigate the excited state structural dynamics of the intramolecular charge transfer of the tetramethoxy anthracene-based fluorophore 2,3,6,7-tetramethoxy 9,10-dibenzaldehydeanthracene (AnDA) and its derivative 2,3,6,7-tetramethoxy 9,10-diphenylanthracene (TMDPAn) in chloroform. In the AnDA molecule, the tetramethoxy anthracene and benzaldehyde moieties exhibit a strong ability to donate and withdraw electrons. Upon photoexcitation, AnDA shows intriguing ultrafast fluorescence switch-on and red shift dynamics on charge transfer states, and the temporal evolution of AnDA recorded by ultrafast spectroscopy reveals a dynamic picture of two-step intramolecular charge transfer assisted by ultrafast conformational changes and solvation processes. Removing the aldehyde group from TMDPAn significantly decreases the electron pulling capacity of the phenyl unit and disables charge transfer characteristics.

12.
J Aging Health ; : 8982643211043668, 2021 Sep 15.
Artigo em Inglês | MEDLINE | ID: mdl-34525884

RESUMO

Objectives: The recent biological clocks GrimAge and PoAm are robust predictors of morbidity and mortality. Little research, however, has investigated the factors that influence their ticking speed. No study has used multivariate analyses to examine whether childhood adversity, adult hardship, lifestyle practices, or some combination of these factors best explains acceleration of these indices. Methods: Using a sample of 506 middle-age African Americans, the present study investigated the extent to which childhood instability, adult adversity, and lifestyle predict accelerated GrimAge and PoAm. Results: The two clocks were highly correlated and the pattern of findings was very similar for the two measures. Childhood instability, adult financial hardship, and smoking were significant predictors of both clocks. Discussion: The findings support a life course perspective where both the long arm of childhood as well as later life conditions influence speed of aging. Similar results across the two clocks enhance confidence in the findings.

13.
J Health Soc Behav ; 62(3): 436-453, 2021 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-34528488

RESUMO

Research on biological embedding of the social environment has been expedited by increased availability of biomarkers. Recently, this arsenal of measures has been expanded to include epigenetic clocks that indicate in years the extent to which an individual is older or younger than their chronological age. These measures of biological aging, especially GrimAge, are robust predictors of both illness and time to death. Importantly for sociologists, several studies have linked social conditions to these indices of aging. The present study extends this research using longitudinal data from a sample of 223 black women participating in the Family and Community Health Study. We find that changes in income and living arrangements over an 11-year period predict changes in speed of biological aging. These results provide further support for the idea that epigenetic aging is a mechanism whereby social conditions become biologically embedded. The utility of epigenetic clocks for sociological studies of health are discussed.

14.
Bioengineered ; 12(1): 6713-6723, 2021 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-34519634

RESUMO

Long non-coding RNA (lncRNA) FGD5 antisense RNA 1 (FGD5-AS1) was reported to exert critical roles in multiple cancers. The current work aimed to determine the role of FGD5-AS1 in cisplatin (DDP) resistance of hepatocellular carcinoma (HCC). The levels of FGD5-AS1, miR-153-3p, and twinfilin actin binding protein 1 (TWF1) were analyzed using RT-qPCR. CCK-8, colony formation, Transwell, and TUNEL assays were used to examine the IC50 value of DDP, cell viability, invasion, and apoptosis. The interaction between miR-153-3p and TWF1 or FGD5-AS1 was determined by luciferase reporter and RIP assays. In our study, we found that FGD5-AS1 level was elevated in DDP-resistant HCC tissues and cell lines. FGD5-AS1 silencing improved the sensitivity of HCC cells to DDP. Moreover, FGD5-AS1 directly bound to miR-153-3p and FGD5-AS1 addition neutralized the inhibitory impacts of miR-153-3p supplementation on DDP resistance in the HCC cells. In addition, knockdown of TWF1 inhibited DDP resistance of HCC cells, which was reversed by miR-153-3p deletion. Lastly, FGD5-AS1 interference decreased TWF1 expression level, which was rescued by miR-153-3p inhibition. Our study exhibited that FGD5-AS1 promoted DDP resistance through modulating the miR-153-3p/TWF1 axis in HCC cells. This could be an effective treatment strategy for HCC patients.

15.
Brain Inj ; : 1-8, 2021 Sep 13.
Artigo em Inglês | MEDLINE | ID: mdl-34516315

RESUMO

OBJECTIVE: Examine effects of age cohort on post-injury life satisfaction in elderly persons with TBIDesign: Retrospective cohortSetting: TBI Model Systems centers. PARTICIPANTS: 5,109 elderly participants with TBI in the TBI Model Systems National DatabaseInterventions: Not applicableMain Outcome Measures: Demographics, injury characteristics and cause, outcomes, age at time of analysis, time to follow commands, maximum follow-up period, and scores on the Satisfaction With Life Scale (SWLS) and Participation Assessment with Recombined Tools-Objective (PART-O) scores at 1, 2, 5, or 10 years post-injury. RESULTS: Life satisfaction post-TBI across groups increased with age. The young-old sub-group demonstrated the poorest life satisfaction outcomes, while the oldest sub-group experienced greatest life satisfaction. In contrast, participation decreased with age. CONCLUSIONS: Findings show diversity in satisfaction with life following moderate to severe TBI for three elderly age-cohorts. Differences may be due to variations in generation-based lived experience, in perceived meaningfulness of participation, could echo prior evidence of greater resilience in the oldest group, or could reflect bias within the study sample. Further research into between- and within- differences for elderly TBI age cohorts is needed to more precisely meet their needs for physical and functional rehabilitation as well as psychological supports.

16.
J Am Chem Soc ; 2021 Sep 03.
Artigo em Inglês | MEDLINE | ID: mdl-34478271

RESUMO

The artificial engineering of an enzyme's structural conformation to enhance its activity is highly desired and challenging. Anisotropic reticular chemistry, best illustrated in the case of multivariate metal-organic frameworks (MTV-MOFs), provides a platform to modify a MOF's pore and inner-surface with functionality variations on frameworks to optimize the interior environment and to enhance the specifically targeted property. In this study, we altered the functionality and ratio of linkers in zeolitic imidazolate frameworks (ZIFs), a subclass of MOFs, with the MTV approach to demonstrate a strategy that allows us to optimize the activity of the encapsulated enzyme by continuously tuning the framework-enzyme interaction through the hydrophilicity change in the pores' microenvironment. To systematically study this interaction, we developed the component-adjustment-ternary plot (CAT) method to approach the optimal activity of the encapsulated enzyme BCL and revealed a nonlinear correlation, first incremental and then decremental, between the BCL activity and the hydrophilic linker' ratios in MTV-ZIF-8. These findings indicated there is a spatial arrangement of functional groups along the three-dimensional space across the ZIF-8 crystal with a unique sequence that could change the enzyme structure between closed-lid and open-lid conformations. These conformation changes were confirmed by FTIR spectra and fluorescence studies. The optimized BCL@ZIF-8 is not only thermally and chemically more stable than free BCL in solution, but also doubles the catalytic reactivity in the kinetic resolution reaction with 99% ee of the products.

17.
Sci Rep ; 11(1): 17574, 2021 Sep 02.
Artigo em Inglês | MEDLINE | ID: mdl-34475474

RESUMO

Previous studies have shown that humans have a left spatial attention bias in cognition and behaviour. However, whether there exists a leftward perception bias of gaze direction has not been investigated. To address this gap, we conducted three behavioural experiments using a forced-choice gaze direction judgment task. The point of subjective equality (PSE) was employed to measure whether there was a leftward perception bias of gaze direction, and if there was, whether this bias was modulated by face emotion. The results of experiment 1 showed that the PSE of fearful faces was significantly positive as compared to zero and this effect was not found in angry, happy, and neutral faces, indicating that participants were more likely to judge the gaze direction of fearful faces as directed to their left-side space, namely a leftward perception bias. With the response keys counterbalanced between participants, experiment 2a replicated the findings in experiment 1. To further investigate whether the gaze direction perception variation was contributed by emotional or low-level features of faces, experiment 2b and 3 used inverted faces and inverted eyes, respectively. The results revealed similar leftward perception biases of gaze direction in all types of faces, indicating that gaze direction perception was biased by emotional information in faces rather than low-level facial features. Overall, our study demonstrates that there a fear-specific leftward perception bias in processing gaze direction. These findings shed new light on the cerebral lateralization in humans.

18.
Nanoscale ; 13(31): 13294-13300, 2021 Aug 21.
Artigo em Inglês | MEDLINE | ID: mdl-34477735

RESUMO

Successful delivery of fluorescent nanodiamonds (FNDs) into the cytoplasm is essential to many biological applications. Other applications require FNDs to stay within the endosomes. The diversity of cellular uptake of FNDs and following endosomal escape are less explored. In this article, we quantify particle uptake at a single cell level. We report that FNDs enter into the cells gradually. The number of internalized FNDs per cell differs significantly for the cell lines we investigated at the same incubation time. In HeLa cells we do not see any significant endosomal escape. We also found a wide distribution of FND endosomal escape efficiency within the same cell type. However, compared with HeLa cells, FNDs in HUVECs can easily escape from the endosomes and less than 25% FNDs remained in the vesicles after 4 h incubation time. We believe this work can bring more attention to the diversity of the cells and provide potential guidelines for future studies.


Assuntos
Nanodiamantes , Endossomos , Corantes Fluorescentes , Células HeLa , Humanos
19.
Circulation ; 2021 Sep 10.
Artigo em Inglês | MEDLINE | ID: mdl-34503349

RESUMO

Background: Doxycycline was demonstrated in a retrospective study to be associated with greater survival in patients with light chain (AL) amyloidosis. Therefore, we prospectively compared the efficacy of bortezomib-cyclophosphamide-dexamethasone (CyBorD) and CyBorD combined with doxycycline for cardiac AL amyloidosis. Methods: This was a multicenter, open-label randomized controlled trial. Patients with Mayo 2004 stage II-III AL amyloidosis were included. Patients were randomized to doxycycline 100 mg twice daily along with 9 cycles of CyBorD (doxycycline group) or to 9 cycles of CyBorD alone (control group). The primary outcome was 2-year progression-free survival (PFS). PFS was defined as the time from randomization to death, hematologic progression or organ progression (heart, kidney or liver). Hematologic progression was defined based on substantial increase in free light chain. Increase in either N-terminal pro B-type natriuretic peptide or cardiac troponin was the main criterion for defining cardiac progression. Cardiac PFS, defined as the time from randomization to cardiac progression or death, was compared between groups in an exploratory analysis. The corresponding treatment hazard ratio was estimated using a Cox regression model. Results: 140 patients underwent randomization, with 70 in each group. The median age was 61 (range, 33-78) years with a male: female ratio of 1.75:1. Stage II disease was present in 34 (48.6%) and 33 (47.1%) patients in the doxycycline and control groups, respectively. After a median follow-up duration of 24.4 months, 32/70 (45.7%) of patients in the doxycycline group and 30/70 (42.9%) of patients in the control group experienced progression. PFS was not significantly different between groups (hazard ratio 0.97, 95% CI, 0.59-1.60, p=0.91). Cardiac progression occurred in 29/70 (41.4%) of patients in the doxycycline group and 26/70 (37.1%) of patients in the control group. The death rates for both groups by the end of follow-up was the same, 25/70 (35.7%). There were no significant differences observed for either cardiac PFS (hazard ratio 0.91, 95% CI, 0.54-1.55, p=0.74) or overall survival (hazard ratio 1.04, 95% CI, 0.60-1.81, p=0.89). Conclusions: Our trial demonstrated that doxycycline combined with CyBorD failed to prolong PFS or cardiac PFS compared with CyBorD alone in cardiac AL amyloidosis. Clinical Trial Registration: URL: https://clinicaltrials.gov Unique Identifier: NCT03401372.

20.
Genome Res ; 2021 Sep 09.
Artigo em Inglês | MEDLINE | ID: mdl-34503979

RESUMO

More than 80% of the wheat genome consists of transposable elements (TEs), which act as one major driver of wheat genome evolution. However, their contributions to the regulatory evolution of wheat adaptations remain largely unclear. Here, we created genome-binding maps for 53 transcription factors (TFs) underlying environmental responses by leveraging DAP-seq in Triticum urartu, together with epigenomic profiles. Most TF-binding sites (TFBS) located distally from genes are embedded in TEs, whose functional relevance is supported by purifying selection and active epigenomic features. About 24% of the non-TE TFBS share significantly high sequence similarity with TE-embedded TFBS. These non-TE TFBS have almost no homologous sequences in non-Triticeae species and are potentially derived from Triticeae-specific TEs. The expansion of TE-derived TFBS linked to wheat-specific gene responses, suggesting TEs are an important driving force for regulatory innovations. Altogether, TEs have been significantly and continuously shaping regulatory networks related to wheat genome evolution and adaptation.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...